\
| Variant ID: vg0129591345 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29591345 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTCTATTATTGTATTATATAGCTAGATAGCTCCATCACATCTGTTCTAGAAGCTAGAAACTCTTACATTAATCGAGAGAAATTTTGACCATTATATTATA[G/A]
TGGTCTAAATTGTAGCGATATGAACGATAAATAAAGACATACAGTTGTATACAACCCTAAATTAAGACATAAACCAATAGTTGTATACGTCAAATCCAAT
ATTGGATTTGACGTATACAACTATTGGTTTATGTCTTAATTTAGGGTTGTATACAACTGTATGTCTTTATTTATCGTTCATATCGCTACAATTTAGACCA[C/T]
TATAATATAATGGTCAAAATTTCTCTCGATTAATGTAAGAGTTTCTAGCTTCTAGAACAGATGTGATGGAGCTATCTAGCTATATAATACAATAATAGAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 3.50% | 2.03% | 0.78% | NA |
| All Indica | 2759 | 94.60% | 1.20% | 2.86% | 1.34% | NA |
| All Japonica | 1512 | 91.30% | 8.00% | 0.73% | 0.00% | NA |
| Aus | 269 | 97.00% | 1.50% | 1.49% | 0.00% | NA |
| Indica I | 595 | 91.30% | 2.00% | 6.72% | 0.00% | NA |
| Indica II | 465 | 95.50% | 0.40% | 3.87% | 0.22% | NA |
| Indica III | 913 | 95.40% | 0.50% | 0.22% | 3.83% | NA |
| Indica Intermediate | 786 | 95.50% | 1.90% | 2.42% | 0.13% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 74.20% | 23.60% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 6.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129591345 | G -> A | LOC_Os01g51470.1 | upstream_gene_variant ; 4940.0bp to feature; MODIFIER | silent_mutation | Average:31.018; most accessible tissue: Callus, score: 58.145 | N | N | N | N |
| vg0129591345 | G -> A | LOC_Os01g51490.1 | upstream_gene_variant ; 1002.0bp to feature; MODIFIER | silent_mutation | Average:31.018; most accessible tissue: Callus, score: 58.145 | N | N | N | N |
| vg0129591345 | G -> A | LOC_Os01g51510.1 | upstream_gene_variant ; 2382.0bp to feature; MODIFIER | silent_mutation | Average:31.018; most accessible tissue: Callus, score: 58.145 | N | N | N | N |
| vg0129591345 | G -> A | LOC_Os01g51480.1 | downstream_gene_variant ; 3721.0bp to feature; MODIFIER | silent_mutation | Average:31.018; most accessible tissue: Callus, score: 58.145 | N | N | N | N |
| vg0129591345 | G -> A | LOC_Os01g51500.1 | downstream_gene_variant ; 1370.0bp to feature; MODIFIER | silent_mutation | Average:31.018; most accessible tissue: Callus, score: 58.145 | N | N | N | N |
| vg0129591345 | G -> A | LOC_Os01g51490-LOC_Os01g51500 | intergenic_region ; MODIFIER | silent_mutation | Average:31.018; most accessible tissue: Callus, score: 58.145 | N | N | N | N |
| vg0129591345 | G -> DEL | N | N | silent_mutation | Average:31.018; most accessible tissue: Callus, score: 58.145 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129591345 | NA | 5.76E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129591345 | NA | 4.41E-06 | mr1378 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129591345 | 5.64E-08 | 5.64E-08 | mr1663 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129591345 | NA | 5.41E-07 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129591345 | 3.12E-07 | NA | mr1124_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129591345 | NA | 1.37E-09 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |