\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129591345:

Variant ID: vg0129591345 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29591345
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTCTATTATTGTATTATATAGCTAGATAGCTCCATCACATCTGTTCTAGAAGCTAGAAACTCTTACATTAATCGAGAGAAATTTTGACCATTATATTATA[G/A]
TGGTCTAAATTGTAGCGATATGAACGATAAATAAAGACATACAGTTGTATACAACCCTAAATTAAGACATAAACCAATAGTTGTATACGTCAAATCCAAT

Reverse complement sequence

ATTGGATTTGACGTATACAACTATTGGTTTATGTCTTAATTTAGGGTTGTATACAACTGTATGTCTTTATTTATCGTTCATATCGCTACAATTTAGACCA[C/T]
TATAATATAATGGTCAAAATTTCTCTCGATTAATGTAAGAGTTTCTAGCTTCTAGAACAGATGTGATGGAGCTATCTAGCTATATAATACAATAATAGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 3.50% 2.03% 0.78% NA
All Indica  2759 94.60% 1.20% 2.86% 1.34% NA
All Japonica  1512 91.30% 8.00% 0.73% 0.00% NA
Aus  269 97.00% 1.50% 1.49% 0.00% NA
Indica I  595 91.30% 2.00% 6.72% 0.00% NA
Indica II  465 95.50% 0.40% 3.87% 0.22% NA
Indica III  913 95.40% 0.50% 0.22% 3.83% NA
Indica Intermediate  786 95.50% 1.90% 2.42% 0.13% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 74.20% 23.60% 2.18% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129591345 G -> A LOC_Os01g51470.1 upstream_gene_variant ; 4940.0bp to feature; MODIFIER silent_mutation Average:31.018; most accessible tissue: Callus, score: 58.145 N N N N
vg0129591345 G -> A LOC_Os01g51490.1 upstream_gene_variant ; 1002.0bp to feature; MODIFIER silent_mutation Average:31.018; most accessible tissue: Callus, score: 58.145 N N N N
vg0129591345 G -> A LOC_Os01g51510.1 upstream_gene_variant ; 2382.0bp to feature; MODIFIER silent_mutation Average:31.018; most accessible tissue: Callus, score: 58.145 N N N N
vg0129591345 G -> A LOC_Os01g51480.1 downstream_gene_variant ; 3721.0bp to feature; MODIFIER silent_mutation Average:31.018; most accessible tissue: Callus, score: 58.145 N N N N
vg0129591345 G -> A LOC_Os01g51500.1 downstream_gene_variant ; 1370.0bp to feature; MODIFIER silent_mutation Average:31.018; most accessible tissue: Callus, score: 58.145 N N N N
vg0129591345 G -> A LOC_Os01g51490-LOC_Os01g51500 intergenic_region ; MODIFIER silent_mutation Average:31.018; most accessible tissue: Callus, score: 58.145 N N N N
vg0129591345 G -> DEL N N silent_mutation Average:31.018; most accessible tissue: Callus, score: 58.145 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129591345 NA 5.76E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345 NA 4.41E-06 mr1378 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345 5.64E-08 5.64E-08 mr1663 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345 NA 5.41E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345 3.12E-07 NA mr1124_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129591345 NA 1.37E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251