\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129570224:

Variant ID: vg0129570224 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29570224
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.81, T: 0.18, others allele: 0.00, population size: 141. )

Flanking Sequence (100 bp) in Reference Genome:


TCTTGTTACCTACTGTATTATTTGTTAGGCAATGCTTTGTGGTAATGTCAAGACACAAGCTCTGATTACATATTATGATTAAAACAAATTCAATTTTTGA[T/A]
TTTTTTTTTGCTACCATTTGAGTTAGCTTTTCTTCTCCATTTAGGTTTTTGATCTGTTTGATGAAAAGAAAAATTCTGTTATTGAATTTGAAGAGTTTAT

Reverse complement sequence

ATAAACTCTTCAAATTCAATAACAGAATTTTTCTTTTCATCAAACAGATCAAAAACCTAAATGGAGAAGAAAAGCTAACTCAAATGGTAGCAAAAAAAAA[A/T]
TCAAAAATTGAATTTGTTTTAATCATAATATGTAATCAGAGCTTGTGTCTTGACATTACCACAAAGCATTGCCTAACAAATAATACAGTAGGTAACAAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.30% 24.30% 2.01% 4.34% NA
All Indica  2759 98.90% 0.80% 0.18% 0.11% NA
All Japonica  1512 9.70% 72.40% 5.56% 12.37% NA
Aus  269 95.90% 1.50% 0.00% 2.60% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.50% 0.30% 0.11% 0.11% NA
Indica Intermediate  786 98.00% 1.50% 0.25% 0.25% NA
Temperate Japonica  767 0.30% 99.20% 0.26% 0.26% NA
Tropical Japonica  504 26.40% 27.20% 14.68% 31.75% NA
Japonica Intermediate  241 5.00% 81.30% 3.32% 10.37% NA
VI/Aromatic  96 94.80% 0.00% 1.04% 4.17% NA
Intermediate  90 55.60% 34.40% 5.56% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129570224 T -> A LOC_Os01g51430.1 upstream_gene_variant ; 2429.0bp to feature; MODIFIER silent_mutation Average:45.687; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0129570224 T -> A LOC_Os01g51410.1 downstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:45.687; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0129570224 T -> A LOC_Os01g51410.2 downstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:45.687; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0129570224 T -> A LOC_Os01g51420.1 intron_variant ; MODIFIER silent_mutation Average:45.687; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N
vg0129570224 T -> DEL N N silent_mutation Average:45.687; most accessible tissue: Zhenshan97 flag leaf, score: 68.25 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129570224 NA 5.52E-81 mr1018 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.25E-58 mr1019 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 5.78E-70 mr1132 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 5.06E-61 mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 9.26E-15 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 1.08E-87 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 9.65E-37 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 6.40E-72 mr1489 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 1.62E-63 mr1491 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 1.68E-43 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 9.24E-10 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 1.05E-20 mr1689 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 6.66E-84 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.29E-25 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 4.11E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 4.97E-82 mr1019_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.59E-83 mr1132_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 3.90E-19 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 4.11E-73 mr1178_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 6.83E-61 mr1261_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.91E-99 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.28E-80 mr1489_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 4.17E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.51E-86 mr1778_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.84E-40 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 2.51E-16 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 1.22E-14 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129570224 NA 7.34E-57 mr1991_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251