| Variant ID: vg0129486709 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 29486709 |
| Reference Allele: C | Alternative Allele: G,CAG,CAGAG |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 154. )
CTTAATGAAATTTGATCAGCCTCTTCCTTTGGCCGATCCGGCTAAAAAGAATATCATGCCAGTGGTTTCACTCACTCACTCACTCACACACACACACACA[C/G,CAG,CAGAG]
ACACAGAGGAAGTGAACTGATTGACCTGAATAATAAACAAAATAATTAAGGATTTACTCGAATATCGGAAAATCCAATAAGGTTTATAGGAATTAACAAA
TTTGTTAATTCCTATAAACCTTATTGGATTTTCCGATATTCGAGTAAATCCTTAATTATTTTGTTTATTATTCAGGTCAATCAGTTCACTTCCTCTGTGT[G/C,CTG,CTCTG]
TGTGTGTGTGTGTGTGAGTGAGTGAGTGAGTGAAACCACTGGCATGATATTCTTTTTAGCCGGATCGGCCAAAGGAAGAGGCTGATCAAATTTCATTAAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 50.40% | 49.20% | 0.21% | 0.00% | CAG: 0.21% |
| All Indica | 2759 | 80.20% | 19.10% | 0.25% | 0.00% | CAG: 0.36% |
| All Japonica | 1512 | 8.30% | 91.50% | 0.13% | 0.00% | NA |
| Aus | 269 | 5.60% | 94.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 61.20% | 38.00% | 0.67% | 0.00% | CAG: 0.17% |
| Indica II | 465 | 97.80% | 1.90% | 0.00% | 0.00% | CAG: 0.22% |
| Indica III | 913 | 84.80% | 14.50% | 0.00% | 0.00% | CAG: 0.77% |
| Indica Intermediate | 786 | 79.00% | 20.50% | 0.38% | 0.00% | CAG: 0.13% |
| Temperate Japonica | 767 | 0.30% | 99.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 23.80% | 75.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 28.90% | 70.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129486709 | C -> G | LOC_Os01g51280.1 | downstream_gene_variant ; 3844.0bp to feature; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> G | LOC_Os01g51280.2 | downstream_gene_variant ; 3844.0bp to feature; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> G | LOC_Os01g51290.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> G | LOC_Os01g51290.2 | intron_variant ; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAG | LOC_Os01g51280.1 | downstream_gene_variant ; 3845.0bp to feature; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAG | LOC_Os01g51280.2 | downstream_gene_variant ; 3845.0bp to feature; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAG | LOC_Os01g51290.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAG | LOC_Os01g51290.2 | intron_variant ; MODIFIER | silent_mutation | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAGAG | LOC_Os01g51280.1 | downstream_gene_variant ; 3845.0bp to feature; MODIFIER | N | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAGAG | LOC_Os01g51280.2 | downstream_gene_variant ; 3845.0bp to feature; MODIFIER | N | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAGAG | LOC_Os01g51290.1 | intron_variant ; MODIFIER | N | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| vg0129486709 | C -> CAGAG | LOC_Os01g51290.2 | intron_variant ; MODIFIER | N | Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129486709 | NA | 3.27E-16 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0129486709 | NA | 4.88E-13 | mr1013 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | NA | 2.49E-13 | mr1031 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | NA | 1.34E-12 | mr1034 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | NA | 6.49E-13 | mr1056 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | NA | 6.17E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | NA | 3.29E-06 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | NA | 1.23E-06 | mr1045_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | 4.59E-06 | 6.21E-09 | mr1060_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129486709 | 6.82E-06 | 9.74E-09 | mr1064_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/