Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129486709:

Variant ID: vg0129486709 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 29486709
Reference Allele: C	Alternative Allele: G,CAG,CAGAG
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:

CTTAATGAAATTTGATCAGCCTCTTCCTTTGGCCGATCCGGCTAAAAAGAATATCATGCCAGTGGTTTCACTCACTCACTCACTCACACACACACACACA[C/G,CAG,CAGAG]
ACACAGAGGAAGTGAACTGATTGACCTGAATAATAAACAAAATAATTAAGGATTTACTCGAATATCGGAAAATCCAATAAGGTTTATAGGAATTAACAAA

Reverse complement sequence

TTTGTTAATTCCTATAAACCTTATTGGATTTTCCGATATTCGAGTAAATCCTTAATTATTTTGTTTATTATTCAGGTCAATCAGTTCACTTCCTCTGTGT[G/C,CTG,CTCTG]
TGTGTGTGTGTGTGTGAGTGAGTGAGTGAGTGAAACCACTGGCATGATATTCTTTTTAGCCGGATCGGCCAAAGGAAGAGGCTGATCAAATTTCATTAAG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.40%	49.20%	0.21%	0.00%	CAG: 0.21%
All Indica	2759	80.20%	19.10%	0.25%	0.00%	CAG: 0.36%
All Japonica	1512	8.30%	91.50%	0.13%	0.00%	NA
Aus	269	5.60%	94.40%	0.00%	0.00%	NA
Indica I	595	61.20%	38.00%	0.67%	0.00%	CAG: 0.17%
Indica II	465	97.80%	1.90%	0.00%	0.00%	CAG: 0.22%
Indica III	913	84.80%	14.50%	0.00%	0.00%	CAG: 0.77%
Indica Intermediate	786	79.00%	20.50%	0.38%	0.00%	CAG: 0.13%
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	23.80%	75.80%	0.40%	0.00%	NA
Japonica Intermediate	241	1.70%	98.30%	0.00%	0.00%	NA
VI/Aromatic	96	2.10%	97.90%	0.00%	0.00%	NA
Intermediate	90	28.90%	70.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129486709	C -> G	LOC_Os01g51280.1	downstream_gene_variant ; 3844.0bp to feature; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> G	LOC_Os01g51280.2	downstream_gene_variant ; 3844.0bp to feature; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> G	LOC_Os01g51290.1	intron_variant ; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> G	LOC_Os01g51290.2	intron_variant ; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAG	LOC_Os01g51280.1	downstream_gene_variant ; 3845.0bp to feature; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAG	LOC_Os01g51280.2	downstream_gene_variant ; 3845.0bp to feature; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAG	LOC_Os01g51290.1	intron_variant ; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAG	LOC_Os01g51290.2	intron_variant ; MODIFIER	silent_mutation	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAGAG	LOC_Os01g51280.1	downstream_gene_variant ; 3845.0bp to feature; MODIFIER	N	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAGAG	LOC_Os01g51280.2	downstream_gene_variant ; 3845.0bp to feature; MODIFIER	N	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAGAG	LOC_Os01g51290.1	intron_variant ; MODIFIER	N	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N
vg0129486709	C -> CAGAG	LOC_Os01g51290.2	intron_variant ; MODIFIER	N	Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129486709	NA	3.27E-16	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0129486709	NA	4.88E-13	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.49E-13	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.34E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	6.49E-13	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	6.17E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	3.29E-06	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.23E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	4.59E-06	6.21E-09	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	6.82E-06	9.74E-09	mr1064_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	6.19E-07	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	4.13E-10	mr1174_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	5.71E-16	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.27E-07	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.09E-22	mr1183_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.68E-08	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.64E-08	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	3.63E-09	mr1220_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.80E-17	mr1260_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.04E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	3.55E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	3.96E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	5.88E-09	mr1319_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	5.01E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.46E-06	mr1320_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.34E-07	mr1320_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.23E-08	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	5.26E-09	mr1327_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.82E-13	mr1330_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.48E-07	mr1330_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.35E-18	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.30E-08	mr1358_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	5.56E-09	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.03E-23	mr1422_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.01E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.20E-06	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.68E-06	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	7.98E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	4.72E-06	1.80E-09	mr1545_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	9.38E-08	mr1579_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	6.29E-06	mr1611_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	5.82E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.78E-07	mr1636_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.36E-06	mr1641_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.94E-07	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	4.38E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.23E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	4.42E-08	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	4.81E-06	mr1767_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.12E-14	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.41E-07	mr1834_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	3.37E-07	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	3.34E-06	mr1838_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	1.60E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709	NA	2.21E-06	mr1959_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251