\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129486709:

Variant ID: vg0129486709 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 29486709
Reference Allele: CAlternative Allele: G,CAG,CAGAG
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.01, others allele: 0.00, population size: 154. )

Flanking Sequence (100 bp) in Reference Genome:


CTTAATGAAATTTGATCAGCCTCTTCCTTTGGCCGATCCGGCTAAAAAGAATATCATGCCAGTGGTTTCACTCACTCACTCACTCACACACACACACACA[C/G,CAG,CAGAG]
ACACAGAGGAAGTGAACTGATTGACCTGAATAATAAACAAAATAATTAAGGATTTACTCGAATATCGGAAAATCCAATAAGGTTTATAGGAATTAACAAA

Reverse complement sequence

TTTGTTAATTCCTATAAACCTTATTGGATTTTCCGATATTCGAGTAAATCCTTAATTATTTTGTTTATTATTCAGGTCAATCAGTTCACTTCCTCTGTGT[G/C,CTG,CTCTG]
TGTGTGTGTGTGTGTGAGTGAGTGAGTGAGTGAAACCACTGGCATGATATTCTTTTTAGCCGGATCGGCCAAAGGAAGAGGCTGATCAAATTTCATTAAG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.40% 49.20% 0.21% 0.00% CAG: 0.21%
All Indica  2759 80.20% 19.10% 0.25% 0.00% CAG: 0.36%
All Japonica  1512 8.30% 91.50% 0.13% 0.00% NA
Aus  269 5.60% 94.40% 0.00% 0.00% NA
Indica I  595 61.20% 38.00% 0.67% 0.00% CAG: 0.17%
Indica II  465 97.80% 1.90% 0.00% 0.00% CAG: 0.22%
Indica III  913 84.80% 14.50% 0.00% 0.00% CAG: 0.77%
Indica Intermediate  786 79.00% 20.50% 0.38% 0.00% CAG: 0.13%
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 23.80% 75.80% 0.40% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 28.90% 70.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129486709 C -> G LOC_Os01g51280.1 downstream_gene_variant ; 3844.0bp to feature; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> G LOC_Os01g51280.2 downstream_gene_variant ; 3844.0bp to feature; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> G LOC_Os01g51290.1 intron_variant ; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> G LOC_Os01g51290.2 intron_variant ; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAG LOC_Os01g51280.1 downstream_gene_variant ; 3845.0bp to feature; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAG LOC_Os01g51280.2 downstream_gene_variant ; 3845.0bp to feature; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAG LOC_Os01g51290.1 intron_variant ; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAG LOC_Os01g51290.2 intron_variant ; MODIFIER silent_mutation Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAGAG LOC_Os01g51280.1 downstream_gene_variant ; 3845.0bp to feature; MODIFIER N Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAGAG LOC_Os01g51280.2 downstream_gene_variant ; 3845.0bp to feature; MODIFIER N Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAGAG LOC_Os01g51290.1 intron_variant ; MODIFIER N Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N
vg0129486709 C -> CAGAG LOC_Os01g51290.2 intron_variant ; MODIFIER N Average:61.943; most accessible tissue: Minghui63 flower, score: 84.698 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129486709 NA 3.27E-16 Plant_height Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0129486709 NA 4.88E-13 mr1013 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.49E-13 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.34E-12 mr1034 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 6.49E-13 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 6.17E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 3.29E-06 mr1839 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.23E-06 mr1045_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 4.59E-06 6.21E-09 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 6.82E-06 9.74E-09 mr1064_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 6.19E-07 mr1128_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 4.13E-10 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 5.71E-16 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.27E-07 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.09E-22 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.68E-08 mr1183_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.64E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 3.63E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.80E-17 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.04E-06 mr1265_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 3.55E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 3.96E-07 mr1302_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 5.88E-09 mr1319_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 5.01E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.46E-06 mr1320_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.34E-07 mr1320_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.23E-08 mr1327_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 5.26E-09 mr1327_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.82E-13 mr1330_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.48E-07 mr1330_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.35E-18 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.30E-08 mr1358_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 5.56E-09 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.03E-23 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.01E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.20E-06 mr1478_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.68E-06 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 7.98E-06 mr1528_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 4.72E-06 1.80E-09 mr1545_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 9.38E-08 mr1579_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 6.29E-06 mr1611_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 5.82E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.78E-07 mr1636_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.36E-06 mr1641_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.94E-07 mr1653_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 4.38E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.23E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 4.42E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 4.81E-06 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.12E-14 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.41E-07 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 3.37E-07 mr1836_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 3.34E-06 mr1838_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 1.60E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129486709 NA 2.21E-06 mr1959_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251