\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129442068:

Variant ID: vg0129442068 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29442068
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, A: 0.21, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAAATTTTTTTACAAATATAAAAAATAAAAAGTTGTGCTTAAAGTACTGTAGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTCAAAAAA[T/A]
TTTAAATAAGACGAGCGGTCAAACGTTGCAAGAAAAACTCAAAATCCCTTATATTATAGGACCGAGGGAGTATTTGTTTCTCCAGTGTCTCCGCTCTGAT

Reverse complement sequence

ATCAGAGCGGAGACACTGGAGAAACAAATACTCCCTCGGTCCTATAATATAAGGGATTTTGAGTTTTTCTTGCAACGTTTGACCGCTCGTCTTATTTAAA[A/T]
TTTTTTGAAATTATTATTTATTTTATTTGTGACTTACTTTATTATCTACAGTACTTTAAGCACAACTTTTTATTTTTTATATTTGTAAAAAAATTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.50% 22.20% 0.25% 0.11% NA
All Indica  2759 99.30% 0.60% 0.14% 0.00% NA
All Japonica  1512 32.40% 66.80% 0.46% 0.33% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 98.80% 0.80% 0.34% 0.00% NA
Indica II  465 99.10% 0.60% 0.22% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.00% 0.90% 0.13% 0.00% NA
Temperate Japonica  767 0.80% 99.20% 0.00% 0.00% NA
Tropical Japonica  504 89.50% 8.30% 1.19% 0.99% NA
Japonica Intermediate  241 13.70% 85.90% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129442068 T -> A LOC_Os01g51210.1 upstream_gene_variant ; 2186.0bp to feature; MODIFIER silent_mutation Average:74.919; most accessible tissue: Callus, score: 99.283 N N N N
vg0129442068 T -> A LOC_Os01g51220.1 upstream_gene_variant ; 582.0bp to feature; MODIFIER silent_mutation Average:74.919; most accessible tissue: Callus, score: 99.283 N N N N
vg0129442068 T -> A LOC_Os01g51210.2 upstream_gene_variant ; 2187.0bp to feature; MODIFIER silent_mutation Average:74.919; most accessible tissue: Callus, score: 99.283 N N N N
vg0129442068 T -> A LOC_Os01g51210-LOC_Os01g51220 intergenic_region ; MODIFIER silent_mutation Average:74.919; most accessible tissue: Callus, score: 99.283 N N N N
vg0129442068 T -> DEL N N silent_mutation Average:74.919; most accessible tissue: Callus, score: 99.283 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129442068 NA 3.23E-06 mr1013 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 3.98E-06 mr1031 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 3.07E-06 mr1056 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 1.21E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 2.68E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 3.13E-06 NA mr1040_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 3.68E-07 7.04E-13 mr1304_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 9.18E-07 mr1346_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 3.57E-06 mr1633_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 3.54E-07 mr1696_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 2.97E-06 mr1707_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 1.24E-07 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129442068 NA 6.64E-10 mr1942_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251