\
| Variant ID: vg0129442068 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29442068 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.79, A: 0.21, others allele: 0.00, population size: 100. )
ATTTAAATTTTTTTACAAATATAAAAAATAAAAAGTTGTGCTTAAAGTACTGTAGATAATAAAGTAAGTCACAAATAAAATAAATAATAATTTCAAAAAA[T/A]
TTTAAATAAGACGAGCGGTCAAACGTTGCAAGAAAAACTCAAAATCCCTTATATTATAGGACCGAGGGAGTATTTGTTTCTCCAGTGTCTCCGCTCTGAT
ATCAGAGCGGAGACACTGGAGAAACAAATACTCCCTCGGTCCTATAATATAAGGGATTTTGAGTTTTTCTTGCAACGTTTGACCGCTCGTCTTATTTAAA[A/T]
TTTTTTGAAATTATTATTTATTTTATTTGTGACTTACTTTATTATCTACAGTACTTTAAGCACAACTTTTTATTTTTTATATTTGTAAAAAAATTTAAAT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.50% | 22.20% | 0.25% | 0.11% | NA |
| All Indica | 2759 | 99.30% | 0.60% | 0.14% | 0.00% | NA |
| All Japonica | 1512 | 32.40% | 66.80% | 0.46% | 0.33% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.80% | 0.34% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.00% | 0.90% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 89.50% | 8.30% | 1.19% | 0.99% | NA |
| Japonica Intermediate | 241 | 13.70% | 85.90% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129442068 | T -> A | LOC_Os01g51210.1 | upstream_gene_variant ; 2186.0bp to feature; MODIFIER | silent_mutation | Average:74.919; most accessible tissue: Callus, score: 99.283 | N | N | N | N |
| vg0129442068 | T -> A | LOC_Os01g51220.1 | upstream_gene_variant ; 582.0bp to feature; MODIFIER | silent_mutation | Average:74.919; most accessible tissue: Callus, score: 99.283 | N | N | N | N |
| vg0129442068 | T -> A | LOC_Os01g51210.2 | upstream_gene_variant ; 2187.0bp to feature; MODIFIER | silent_mutation | Average:74.919; most accessible tissue: Callus, score: 99.283 | N | N | N | N |
| vg0129442068 | T -> A | LOC_Os01g51210-LOC_Os01g51220 | intergenic_region ; MODIFIER | silent_mutation | Average:74.919; most accessible tissue: Callus, score: 99.283 | N | N | N | N |
| vg0129442068 | T -> DEL | N | N | silent_mutation | Average:74.919; most accessible tissue: Callus, score: 99.283 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129442068 | NA | 3.23E-06 | mr1013 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 3.98E-06 | mr1031 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 3.07E-06 | mr1056 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 1.21E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 2.68E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | 3.13E-06 | NA | mr1040_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | 3.68E-07 | 7.04E-13 | mr1304_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 9.18E-07 | mr1346_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 3.57E-06 | mr1633_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 3.54E-07 | mr1696_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 2.97E-06 | mr1707_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 1.24E-07 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129442068 | NA | 6.64E-10 | mr1942_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |