\
| Variant ID: vg0129430227 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29430227 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGCGCGCGTGTTCCCCCTATTCTCTCCACTACACATGCTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTAAGGAGGTCCCCCTCTCTTAGAATAAGTAAG[G/A]
TGGTACTAAACTCCACATGCATGCCATCCCATGAGGTGGGTTTTTGTGATTTTCCAAAGAATTAATCTTCAAGTGGGCTAAGGCCCATCCATTAATTCCA
TGGAATTAATGGATGGGCCTTAGCCCACTTGAAGATTAATTCTTTGGAAAATCACAAAAACCCACCTCATGGGATGGCATGCATGTGGAGTTTAGTACCA[C/T]
CTTACTTATTCTAAGAGAGGGGGACCTCCTTAAAAGGGAGGATGCCCTCCTAGCCACTTGAAGCATGTGTAGTGGAGAGAATAGGGGGAACACGCGCGCT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.40% | 1.00% | 3.68% | 5.95% | NA |
| All Indica | 2759 | 90.20% | 0.90% | 3.73% | 5.18% | NA |
| All Japonica | 1512 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Aus | 269 | 50.60% | 4.80% | 12.27% | 32.34% | NA |
| Indica I | 595 | 65.90% | 3.50% | 13.28% | 17.31% | NA |
| Indica II | 465 | 99.80% | 0.00% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.80% | 0.00% | 0.66% | 0.55% | NA |
| Indica Intermediate | 786 | 93.00% | 0.40% | 2.29% | 4.33% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 97.50% | 0.00% | 0.83% | 1.66% | NA |
| VI/Aromatic | 96 | 17.70% | 6.20% | 35.42% | 40.62% | NA |
| Intermediate | 90 | 86.70% | 2.20% | 2.22% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129430227 | G -> A | LOC_Os01g51200.1 | upstream_gene_variant ; 1433.0bp to feature; MODIFIER | silent_mutation | Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448 | N | N | N | N |
| vg0129430227 | G -> A | LOC_Os01g51200.2 | upstream_gene_variant ; 1374.0bp to feature; MODIFIER | silent_mutation | Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448 | N | N | N | N |
| vg0129430227 | G -> A | LOC_Os01g51190.1 | downstream_gene_variant ; 2112.0bp to feature; MODIFIER | silent_mutation | Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448 | N | N | N | N |
| vg0129430227 | G -> A | LOC_Os01g51190-LOC_Os01g51200 | intergenic_region ; MODIFIER | silent_mutation | Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448 | N | N | N | N |
| vg0129430227 | G -> DEL | N | N | silent_mutation | Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129430227 | NA | 7.56E-06 | mr1070 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 6.58E-07 | mr1180 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 5.17E-09 | mr1839 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 2.99E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 1.48E-06 | mr1265_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 4.76E-06 | mr1274_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 5.34E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 3.11E-08 | mr1406_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 1.94E-08 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129430227 | NA | 2.13E-08 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |