Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0129430227:

Variant ID: vg0129430227 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29430227
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCGCGCGTGTTCCCCCTATTCTCTCCACTACACATGCTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTAAGGAGGTCCCCCTCTCTTAGAATAAGTAAG[G/A]
TGGTACTAAACTCCACATGCATGCCATCCCATGAGGTGGGTTTTTGTGATTTTCCAAAGAATTAATCTTCAAGTGGGCTAAGGCCCATCCATTAATTCCA

Reverse complement sequence

TGGAATTAATGGATGGGCCTTAGCCCACTTGAAGATTAATTCTTTGGAAAATCACAAAAACCCACCTCATGGGATGGCATGCATGTGGAGTTTAGTACCA[C/T]
CTTACTTATTCTAAGAGAGGGGGACCTCCTTAAAAGGGAGGATGCCCTCCTAGCCACTTGAAGCATGTGTAGTGGAGAGAATAGGGGGAACACGCGCGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.40%	1.00%	3.68%	5.95%	NA
All Indica	2759	90.20%	0.90%	3.73%	5.18%	NA
All Japonica	1512	99.60%	0.00%	0.13%	0.26%	NA
Aus	269	50.60%	4.80%	12.27%	32.34%	NA
Indica I	595	65.90%	3.50%	13.28%	17.31%	NA
Indica II	465	99.80%	0.00%	0.00%	0.22%	NA
Indica III	913	98.80%	0.00%	0.66%	0.55%	NA
Indica Intermediate	786	93.00%	0.40%	2.29%	4.33%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	97.50%	0.00%	0.83%	1.66%	NA
VI/Aromatic	96	17.70%	6.20%	35.42%	40.62%	NA
Intermediate	90	86.70%	2.20%	2.22%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129430227	G -> A	LOC_Os01g51200.1	upstream_gene_variant ; 1433.0bp to feature; MODIFIER	silent_mutation	Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0129430227	G -> A	LOC_Os01g51200.2	upstream_gene_variant ; 1374.0bp to feature; MODIFIER	silent_mutation	Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0129430227	G -> A	LOC_Os01g51190.1	downstream_gene_variant ; 2112.0bp to feature; MODIFIER	silent_mutation	Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0129430227	G -> A	LOC_Os01g51190-LOC_Os01g51200	intergenic_region ; MODIFIER	silent_mutation	Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N
vg0129430227	G -> DEL	N	N	silent_mutation	Average:58.631; most accessible tissue: Zhenshan97 root, score: 80.448	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129430227	NA	7.56E-06	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	6.58E-07	mr1180	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	5.17E-09	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	2.99E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	1.48E-06	mr1265_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	4.76E-06	mr1274_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	5.34E-08	mr1347_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	3.11E-08	mr1406_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	1.94E-08	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129430227	NA	2.13E-08	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251