\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129388746:

Variant ID: vg0129388746 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29388746
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCCCACCTATCATACACATTACGTATTAGAGTTCGTGCTGCAGTTGTCTGCTCCTCACTCTCTTCTTTTATCTCTTTAAAATTTTAAAATATGTTTATAG[T/C]
TAGCTTATAGTCCATTATTGTACTGCTCTTATCCAGCTTCCTTAATAAATACTATAAACAACTCCATACAGATTTTAATCCTTAAAAAAAAAACTCCCTT

Reverse complement sequence

AAGGGAGTTTTTTTTTTAAGGATTAAAATCTGTATGGAGTTGTTTATAGTATTTATTAAGGAAGCTGGATAAGAGCAGTACAATAATGGACTATAAGCTA[A/G]
CTATAAACATATTTTAAAATTTTAAAGAGATAAAAGAAGAGAGTGAGGAGCAGACAACTGCAGCACGAACTCTAATACGTAATGTGTATGATAGGTGGGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.10% 17.60% 0.21% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 45.80% 53.60% 0.60% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 9.50% 90.00% 0.52% 0.00% NA
Tropical Japonica  504 95.20% 4.40% 0.40% 0.00% NA
Japonica Intermediate  241 57.70% 41.10% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 78.90% 20.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129388746 T -> C LOC_Os01g51140.1 upstream_gene_variant ; 3100.0bp to feature; MODIFIER silent_mutation Average:55.306; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0129388746 T -> C LOC_Os01g51140.2 upstream_gene_variant ; 3093.0bp to feature; MODIFIER silent_mutation Average:55.306; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N
vg0129388746 T -> C LOC_Os01g51140-LOC_Os01g51154 intergenic_region ; MODIFIER silent_mutation Average:55.306; most accessible tissue: Zhenshan97 root, score: 85.677 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129388746 NA 1.92E-23 mr1115 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 3.43E-09 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 1.79E-06 1.87E-17 mr1593 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 7.31E-07 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 3.36E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 4.44E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 5.88E-22 mr1920 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 9.37E-40 mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 6.23E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 2.36E-10 mr1959 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 5.61E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 1.51E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129388746 NA 7.29E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251