Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129380015:

Variant ID: vg0129380015 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29380015
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATAACAAGTTTAACTGGTTAGGTTACACATGGTGGAATCAGCTCACCAGGATTCAAGTTATAAACTTGACATGGTTACTTGCATTTACGGCTCATTACT[C/A]
TTTCGGTGGTAGGCAATGTACCTGTCAATAGCAAGACACCCATGGTGACTTCCTCAATCAACCCAGTCTTCCGGAGGTCCTCATATCGGGTCAGTCGACA

Reverse complement sequence

TGTCGACTGACCCGATATGAGGACCTCCGGAAGACTGGGTTGATTGAGGAAGTCACCATGGGTGTCTTGCTATTGACAGGTACATTGCCTACCACCGAAA[G/T]
AGTAATGAGCCGTAAATGCAAGTAACCATGTCAAGTTTATAACTTGAATCCTGGTGAGCTGATTCCACCATGTGTAACCTAACCAGTTAAACTTGTTATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	44.90%	0.19%	0.00%	NA
All Indica	2759	80.20%	19.60%	0.22%	0.00%	NA
All Japonica	1512	9.20%	90.70%	0.13%	0.00%	NA
Aus	269	44.60%	55.00%	0.37%	0.00%	NA
Indica I	595	60.70%	38.50%	0.84%	0.00%	NA
Indica II	465	97.80%	2.20%	0.00%	0.00%	NA
Indica III	913	83.20%	16.80%	0.00%	0.00%	NA
Indica Intermediate	786	80.90%	19.00%	0.13%	0.00%	NA
Temperate Japonica	767	0.30%	99.70%	0.00%	0.00%	NA
Tropical Japonica	504	25.60%	74.20%	0.20%	0.00%	NA
Japonica Intermediate	241	3.30%	96.30%	0.41%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	43.30%	56.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129380015	C -> A	LOC_Os01g51130.1	upstream_gene_variant ; 3892.0bp to feature; MODIFIER	silent_mutation	Average:65.163; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0129380015	C -> A	LOC_Os01g51140.1	downstream_gene_variant ; 2693.0bp to feature; MODIFIER	silent_mutation	Average:65.163; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0129380015	C -> A	LOC_Os01g51140.2	downstream_gene_variant ; 2519.0bp to feature; MODIFIER	silent_mutation	Average:65.163; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N
vg0129380015	C -> A	LOC_Os01g51130-LOC_Os01g51140	intergenic_region ; MODIFIER	silent_mutation	Average:65.163; most accessible tissue: Minghui63 panicle, score: 86.442	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129380015	NA	5.55E-19	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0129380015	NA	1.71E-07	mr1011	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	3.10E-14	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	6.05E-06	mr1014	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	2.80E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	8.66E-07	mr1031	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	1.25E-12	mr1034	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	7.71E-15	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	7.86E-07	mr1056	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	1.95E-07	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	2.78E-06	mr1479	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	2.31E-07	mr1502	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	5.57E-07	mr1543	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	7.95E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	8.56E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	1.19E-07	mr1839	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	4.99E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	9.37E-06	mr1919	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	4.22E-08	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	3.57E-06	2.33E-09	mr1064_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	2.71E-07	mr1183_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	2.95E-06	mr1265_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	4.72E-08	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	6.94E-06	mr1296_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	1.30E-06	mr1320_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	3.98E-07	mr1320_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	4.00E-07	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	8.53E-08	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	1.01E-06	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	2.63E-06	mr1528_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	1.18E-08	mr1545_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	5.68E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	4.94E-06	mr1636_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	3.22E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	2.14E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	3.92E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	7.26E-11	mr1758_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	6.54E-06	mr1836_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129380015	NA	7.59E-06	mr1899_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251