\
| Variant ID: vg0129289299 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29289299 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TCTCAGAGAAATACCATGAAGGCAATAGGGTTATCCGGCGTAATTGATGATCTCGGTCGTTGAAATTTGTACTTTGTTTCGACTTTTTTTAAGTCAAACT[A/T]
CTTCAAAGTTTAATCAAATTTATTATAGAAAAATATAAAAACAGTTATAGCACCAAATTAGTTTCATTACATTTAATATTGAACATATTTTTTTCTAAAA
TTTTAGAAAAAAATATGTTCAATATTAAATGTAATGAAACTAATTTGGTGCTATAACTGTTTTTATATTTTTCTATAATAAATTTGATTAAACTTTGAAG[T/A]
AGTTTGACTTAAAAAAAGTCGAAACAAAGTACAAATTTCAACGACCGAGATCATCAATTACGCCGGATAACCCTATTGCCTTCATGGTATTTCTCTGAGA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.60% | 21.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 36.60% | 63.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.60% | 89.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 66.90% | 33.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 56.40% | 43.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129289299 | A -> T | LOC_Os01g50980.1 | upstream_gene_variant ; 1027.0bp to feature; MODIFIER | silent_mutation | Average:31.074; most accessible tissue: Callus, score: 87.215 | N | N | N | N |
| vg0129289299 | A -> T | LOC_Os01g50970.1 | downstream_gene_variant ; 581.0bp to feature; MODIFIER | silent_mutation | Average:31.074; most accessible tissue: Callus, score: 87.215 | N | N | N | N |
| vg0129289299 | A -> T | LOC_Os01g50970-LOC_Os01g50980 | intergenic_region ; MODIFIER | silent_mutation | Average:31.074; most accessible tissue: Callus, score: 87.215 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129289299 | NA | 9.13E-08 | mr1190 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 1.40E-16 | mr1276 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 5.41E-07 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | 3.73E-07 | NA | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | 1.30E-06 | 3.81E-09 | mr1657 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | 4.58E-06 | NA | mr1676 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 1.43E-09 | mr1690 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 2.32E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 2.72E-07 | mr1582_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 1.29E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | 4.45E-07 | NA | mr1676_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 7.96E-07 | mr1695_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129289299 | NA | 2.00E-16 | mr1730_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |