\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129289299:

Variant ID: vg0129289299 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29289299
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCAGAGAAATACCATGAAGGCAATAGGGTTATCCGGCGTAATTGATGATCTCGGTCGTTGAAATTTGTACTTTGTTTCGACTTTTTTTAAGTCAAACT[A/T]
CTTCAAAGTTTAATCAAATTTATTATAGAAAAATATAAAAACAGTTATAGCACCAAATTAGTTTCATTACATTTAATATTGAACATATTTTTTTCTAAAA

Reverse complement sequence

TTTTAGAAAAAAATATGTTCAATATTAAATGTAATGAAACTAATTTGGTGCTATAACTGTTTTTATATTTTTCTATAATAAATTTGATTAAACTTTGAAG[T/A]
AGTTTGACTTAAAAAAAGTCGAAACAAAGTACAAATTTCAACGACCGAGATCATCAATTACGCCGGATAACCCTATTGCCTTCATGGTATTTCTCTGAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.60% 21.40% 0.00% 0.00% NA
All Indica  2759 99.40% 0.60% 0.00% 0.00% NA
All Japonica  1512 36.60% 63.40% 0.00% 0.00% NA
Aus  269 97.80% 2.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 10.60% 89.40% 0.00% 0.00% NA
Tropical Japonica  504 66.90% 33.10% 0.00% 0.00% NA
Japonica Intermediate  241 56.40% 43.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129289299 A -> T LOC_Os01g50980.1 upstream_gene_variant ; 1027.0bp to feature; MODIFIER silent_mutation Average:31.074; most accessible tissue: Callus, score: 87.215 N N N N
vg0129289299 A -> T LOC_Os01g50970.1 downstream_gene_variant ; 581.0bp to feature; MODIFIER silent_mutation Average:31.074; most accessible tissue: Callus, score: 87.215 N N N N
vg0129289299 A -> T LOC_Os01g50970-LOC_Os01g50980 intergenic_region ; MODIFIER silent_mutation Average:31.074; most accessible tissue: Callus, score: 87.215 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129289299 NA 9.13E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 1.40E-16 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 5.41E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 3.73E-07 NA mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 1.30E-06 3.81E-09 mr1657 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 4.58E-06 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 1.43E-09 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 2.32E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 2.72E-07 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 1.29E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 4.45E-07 NA mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 7.96E-07 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129289299 NA 2.00E-16 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251