Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129279095:

Variant ID: vg0129279095 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29279095
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGCAACTTGTAGCATTACAAGAGGATGGTGTATTGGTAAGAATTGAAAAGATGGTTGACAAGTTGCAAAGGTTCGGTTCCTCGTCTCATGTCTCGTCTG[C/T]
ACTCTCTCCGTCCAATAAAAAACGAATCTAAAACTGGATGTGACATATTTTAGTACGATGAATTTGACATATATATATCCAGATTCATAGTACTAAAATA

Reverse complement sequence

TATTTTAGTACTATGAATCTGGATATATATATGTCAAATTCATCGTACTAAAATATGTCACATCCAGTTTTAGATTCGTTTTTTATTGGACGGAGAGAGT[G/A]
CAGACGAGACATGAGACGAGGAACCGAACCTTTGCAACTTGTCAACCATCTTTTCAATTCTTACCAATACACCATCCTCTTGTAATGCTACAAGTTGCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 8.00% 0.02% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 77.10% 22.80% 0.07% 0.00% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 89.70% 10.30% 0.00% 0.00% NA
Tropical Japonica  504 71.20% 28.80% 0.00% 0.00% NA
Japonica Intermediate  241 49.40% 50.20% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129279095 C -> T LOC_Os01g50950.1 downstream_gene_variant ; 1288.0bp to feature; MODIFIER silent_mutation Average:92.656; most accessible tissue: Zhenshan97 young leaf, score: 97.586 N N N N
vg0129279095 C -> T LOC_Os01g50960.1 downstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:92.656; most accessible tissue: Zhenshan97 young leaf, score: 97.586 N N N N
vg0129279095 C -> T LOC_Os01g50950-LOC_Os01g50960 intergenic_region ; MODIFIER silent_mutation Average:92.656; most accessible tissue: Zhenshan97 young leaf, score: 97.586 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0129279095 C T 0.03 0.04 0.05 0.03 0.02 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129279095 NA 3.04E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 NA 6.10E-16 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 NA 4.56E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 1.46E-07 NA mr1657 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 2.53E-06 5.12E-09 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 6.75E-07 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 8.33E-06 7.01E-10 mr1690 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 NA 7.25E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129279095 NA 1.55E-07 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251