Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129276978:

Variant ID: vg0129276978 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29276978
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCGTCACATATGATAAAAGCTAATCTCGTATTAGATGTGATTTTGAATGTTCGCGAAGACGAAGAGATTAGAACTTAAACCAAGTACTTTTGGGACAG[T/A]
GGGAGTACTATATGCCTTTCGTCACATATGATAAAAGTTAATCTCGTATTAGATGTGATTTTGAATGTTCATGAAGACGAAGAGATTAGAACTTAAACCA

Reverse complement sequence

TGGTTTAAGTTCTAATCTCTTCGTCTTCATGAACATTCAAAATCACATCTAATACGAGATTAACTTTTATCATATGTGACGAAAGGCATATAGTACTCCC[A/T]
CTGTCCCAAAAGTACTTGGTTTAAGTTCTAATCTCTTCGTCTTCGCGAACATTCAAAATCACATCTAATACGAGATTAGCTTTTATCATATGTGACGGAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.40%	22.40%	3.17%	4.04%	NA
All Indica	2759	91.70%	1.00%	2.07%	5.18%	NA
All Japonica	1512	34.90%	63.40%	1.19%	0.46%	NA
Aus	269	56.90%	10.00%	20.45%	12.64%	NA
Indica I	595	75.30%	0.20%	5.88%	18.66%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	98.10%	0.40%	0.88%	0.55%	NA
Indica Intermediate	786	92.70%	2.00%	1.78%	3.44%	NA
Temperate Japonica	767	10.60%	89.40%	0.00%	0.00%	NA
Tropical Japonica	504	62.50%	33.30%	2.98%	1.19%	NA
Japonica Intermediate	241	54.80%	43.60%	1.24%	0.41%	NA
VI/Aromatic	96	67.70%	11.50%	15.62%	5.21%	NA
Intermediate	90	55.60%	36.70%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129276978	T -> A	LOC_Os01g50950.1	upstream_gene_variant ; 509.0bp to feature; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Callus, score: 87.611	N	N	N	N
vg0129276978	T -> A	LOC_Os01g50940.1	downstream_gene_variant ; 3708.0bp to feature; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Callus, score: 87.611	N	N	N	N
vg0129276978	T -> A	LOC_Os01g50960.1	downstream_gene_variant ; 3148.0bp to feature; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Callus, score: 87.611	N	N	N	N
vg0129276978	T -> A	LOC_Os01g50940-LOC_Os01g50950	intergenic_region ; MODIFIER	silent_mutation	Average:64.358; most accessible tissue: Callus, score: 87.611	N	N	N	N
vg0129276978	T -> DEL	N	N	silent_mutation	Average:64.358; most accessible tissue: Callus, score: 87.611	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129276978	NA	6.83E-08	mr1190	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	3.70E-17	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	5.15E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	3.86E-07	NA	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	2.53E-06	5.12E-09	mr1657	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	2.91E-06	NA	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	9.73E-10	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	1.42E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	9.93E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	1.53E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	7.25E-08	mr1582_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	1.55E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	3.64E-07	NA	mr1676_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	1.55E-07	mr1695_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	5.34E-17	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978	NA	3.32E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251