\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129276978:

Variant ID: vg0129276978 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29276978
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCGTCACATATGATAAAAGCTAATCTCGTATTAGATGTGATTTTGAATGTTCGCGAAGACGAAGAGATTAGAACTTAAACCAAGTACTTTTGGGACAG[T/A]
GGGAGTACTATATGCCTTTCGTCACATATGATAAAAGTTAATCTCGTATTAGATGTGATTTTGAATGTTCATGAAGACGAAGAGATTAGAACTTAAACCA

Reverse complement sequence

TGGTTTAAGTTCTAATCTCTTCGTCTTCATGAACATTCAAAATCACATCTAATACGAGATTAACTTTTATCATATGTGACGAAAGGCATATAGTACTCCC[A/T]
CTGTCCCAAAAGTACTTGGTTTAAGTTCTAATCTCTTCGTCTTCGCGAACATTCAAAATCACATCTAATACGAGATTAGCTTTTATCATATGTGACGGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.40% 22.40% 3.17% 4.04% NA
All Indica  2759 91.70% 1.00% 2.07% 5.18% NA
All Japonica  1512 34.90% 63.40% 1.19% 0.46% NA
Aus  269 56.90% 10.00% 20.45% 12.64% NA
Indica I  595 75.30% 0.20% 5.88% 18.66% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 98.10% 0.40% 0.88% 0.55% NA
Indica Intermediate  786 92.70% 2.00% 1.78% 3.44% NA
Temperate Japonica  767 10.60% 89.40% 0.00% 0.00% NA
Tropical Japonica  504 62.50% 33.30% 2.98% 1.19% NA
Japonica Intermediate  241 54.80% 43.60% 1.24% 0.41% NA
VI/Aromatic  96 67.70% 11.50% 15.62% 5.21% NA
Intermediate  90 55.60% 36.70% 5.56% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129276978 T -> A LOC_Os01g50950.1 upstream_gene_variant ; 509.0bp to feature; MODIFIER silent_mutation Average:64.358; most accessible tissue: Callus, score: 87.611 N N N N
vg0129276978 T -> A LOC_Os01g50940.1 downstream_gene_variant ; 3708.0bp to feature; MODIFIER silent_mutation Average:64.358; most accessible tissue: Callus, score: 87.611 N N N N
vg0129276978 T -> A LOC_Os01g50960.1 downstream_gene_variant ; 3148.0bp to feature; MODIFIER silent_mutation Average:64.358; most accessible tissue: Callus, score: 87.611 N N N N
vg0129276978 T -> A LOC_Os01g50940-LOC_Os01g50950 intergenic_region ; MODIFIER silent_mutation Average:64.358; most accessible tissue: Callus, score: 87.611 N N N N
vg0129276978 T -> DEL N N silent_mutation Average:64.358; most accessible tissue: Callus, score: 87.611 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129276978 NA 6.83E-08 mr1190 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 3.70E-17 mr1276 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 5.15E-07 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 3.86E-07 NA mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 2.53E-06 5.12E-09 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 2.91E-06 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 9.73E-10 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 1.42E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 9.93E-09 mr1986 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 1.53E-20 mr1010_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 7.25E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 1.55E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 3.64E-07 NA mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 1.55E-07 mr1695_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 5.34E-17 mr1730_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129276978 NA 3.32E-15 mr1866_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251