\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129227024:

Variant ID: vg0129227024 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29227024
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATGATTATTATTTTTATTATTATTAGATGATAAAATATGAATAGTATTTTATGTGTGACTAATTTTTTAAAAAATTTTCATAAAATTTTCAAATAAAAC[G/A,T]
GATGGTCAAACGTTGGACACGGATTTCCACGGCTGCTGAGACGGAGGTAGTACGTGCTGGTGGCCTGGTGCTGCTTCATGATGTGATCCTTAACGGTGAG

Reverse complement sequence

CTCACCGTTAAGGATCACATCATGAAGCAGCACCAGGCCACCAGCACGTACTACCTCCGTCTCAGCAGCCGTGGAAATCCGTGTCCAACGTTTGACCATC[C/T,A]
GTTTTATTTGAAAATTTTATGAAAATTTTTTAAAAAATTAGTCACACATAAAATACTATTCATATTTTATCATCTAATAATAATAAAAATAATAATCATA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.70% 11.90% 0.32% 0.00% T: 0.04%
All Indica  2759 96.80% 3.00% 0.14% 0.00% T: 0.04%
All Japonica  1512 86.60% 12.90% 0.53% 0.00% NA
Aus  269 8.60% 91.10% 0.00% 0.00% T: 0.37%
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.70% 1.10% 0.00% 0.00% T: 0.22%
Indica III  913 97.40% 2.40% 0.22% 0.00% NA
Indica Intermediate  786 92.70% 7.00% 0.25% 0.00% NA
Temperate Japonica  767 98.80% 0.80% 0.39% 0.00% NA
Tropical Japonica  504 68.80% 31.00% 0.20% 0.00% NA
Japonica Intermediate  241 84.60% 13.70% 1.66% 0.00% NA
VI/Aromatic  96 75.00% 25.00% 0.00% 0.00% NA
Intermediate  90 78.90% 17.80% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129227024 G -> T LOC_Os01g50870.1 upstream_gene_variant ; 3525.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> T LOC_Os01g50900.1 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> T LOC_Os01g50880.1 downstream_gene_variant ; 60.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> T LOC_Os01g50890.1 downstream_gene_variant ; 3933.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> T LOC_Os01g50880-LOC_Os01g50890 intergenic_region ; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> A LOC_Os01g50870.1 upstream_gene_variant ; 3525.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> A LOC_Os01g50900.1 upstream_gene_variant ; 4876.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> A LOC_Os01g50880.1 downstream_gene_variant ; 60.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> A LOC_Os01g50890.1 downstream_gene_variant ; 3933.0bp to feature; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N
vg0129227024 G -> A LOC_Os01g50880-LOC_Os01g50890 intergenic_region ; MODIFIER silent_mutation Average:97.661; most accessible tissue: Minghui63 root, score: 98.947 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0129227024 G A -0.01 -0.02 -0.02 -0.01 -0.01 -0.02
vg0129227024 G T -0.05 -0.06 -0.05 -0.04 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129227024 NA 1.88E-06 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 2.06E-09 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 2.49E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 6.10E-07 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 2.39E-17 mr1696 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 8.96E-08 mr1706 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 4.84E-06 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 7.16E-17 mr1047_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 3.17E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 9.51E-16 mr1189_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 6.60E-06 mr1291_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 1.79E-06 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 4.09E-11 mr1471_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 1.91E-07 mr1502_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 6.06E-19 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 1.90E-09 mr1543_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 3.57E-13 mr1642_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 1.39E-06 mr1792_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 4.61E-12 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 3.75E-11 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129227024 NA 1.25E-08 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251