\
| Variant ID: vg0129211258 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29211258 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AACATACCAAAAAACTGGATCATCTCCTATCCAGGGATATCCCTTTAACCAAATATAAACTAAGATGCTCATATGATTAATGTATACACTAGAAAAAGCG[T/C]
GCGGCTTTGCCACGTGTGGTACAGTGAGCCTGGCTCATTAGGCCTAGTGAATAGGTAACAAATTAATACACATATATAGAAGAGCCAGATTAATAGTAGA
TCTACTATTAATCTGGCTCTTCTATATATGTGTATTAATTTGTTACCTATTCACTAGGCCTAATGAGCCAGGCTCACTGTACCACACGTGGCAAAGCCGC[A/G]
CGCTTTTTCTAGTGTATACATTAATCATATGAGCATCTTAGTTTATATTTGGTTAAAGGGATATCCCTGGATAGGAGATGATCCAGTTTTTTGGTATGTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.40% | 24.40% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 26.70% | 72.90% | 0.33% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 2.10% | 97.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 70.20% | 29.20% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 14.10% | 85.50% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 10.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 31.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129211258 | T -> C | LOC_Os01g50849.3 | upstream_gene_variant ; 1651.0bp to feature; MODIFIER | silent_mutation | Average:62.042; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0129211258 | T -> C | LOC_Os01g50849.1 | upstream_gene_variant ; 1651.0bp to feature; MODIFIER | silent_mutation | Average:62.042; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0129211258 | T -> C | LOC_Os01g50849.2 | upstream_gene_variant ; 1651.0bp to feature; MODIFIER | silent_mutation | Average:62.042; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| vg0129211258 | T -> C | LOC_Os01g50849-LOC_Os01g50860 | intergenic_region ; MODIFIER | silent_mutation | Average:62.042; most accessible tissue: Minghui63 panicle, score: 84.005 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129211258 | NA | 1.87E-36 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0129211258 | NA | 6.71E-59 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0129211258 | NA | 5.44E-07 | mr1090 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.37E-06 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.21E-94 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 2.64E-33 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 2.89E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 5.06E-51 | mr1771 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 2.27E-14 | mr1771 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 6.61E-40 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 2.77E-07 | mr1785 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.73E-24 | mr1805 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 7.21E-26 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 2.01E-07 | mr1090_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 5.14E-07 | mr1211_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 6.83E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.58E-06 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.26E-104 | mr1334_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 8.24E-08 | mr1526_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 3.35E-07 | mr1551_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 3.28E-27 | mr1584_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 7.65E-41 | mr1771_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.05E-72 | mr1778_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.68E-45 | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 2.27E-13 | mr1800_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 1.47E-39 | mr1862_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129211258 | NA | 2.06E-52 | mr1991_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |