\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129130509:

Variant ID: vg0129130509 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29130509
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTTAGAATTGAGGAGATGGCTATGTTTTTAAATAATTTGTGGCAAAAGTACAATTTTACCCCTACACGTCTATATTTTTATGGATAATCATACCTCTT[C/A]
ATATTTCTACTATTGTTAAATAAGGTTATAGTATAAAAAGATCTGAACTCTCAAATAAAATTAGATTTGTGGTTCAGATCGATTAACTTCTACTACTAGT

Reverse complement sequence

ACTAGTAGTAGAAGTTAATCGATCTGAACCACAAATCTAATTTTATTTGAGAGTTCAGATCTTTTTATACTATAACCTTATTTAACAATAGTAGAAATAT[G/T]
AAGAGGTATGATTATCCATAAAAATATAGACGTGTAGGGGTAAAATTGTACTTTTGCCACAAATTATTTAAAAACATAGCCATCTCCTCAATTCTAACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 5.30% 1.12% 0.00% NA
All Indica  2759 89.30% 8.90% 1.81% 0.00% NA
All Japonica  1512 99.90% 0.00% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 96.10% 0.70% 3.19% 0.00% NA
Indica II  465 86.20% 11.40% 2.37% 0.00% NA
Indica III  913 83.90% 15.30% 0.77% 0.00% NA
Indica Intermediate  786 92.20% 6.10% 1.65% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.00% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129130509 C -> A LOC_Os01g50710.1 upstream_gene_variant ; 420.0bp to feature; MODIFIER silent_mutation Average:33.829; most accessible tissue: Callus, score: 65.349 N N N N
vg0129130509 C -> A LOC_Os01g50720.1 downstream_gene_variant ; 1650.0bp to feature; MODIFIER silent_mutation Average:33.829; most accessible tissue: Callus, score: 65.349 N N N N
vg0129130509 C -> A LOC_Os01g50700-LOC_Os01g50710 intergenic_region ; MODIFIER silent_mutation Average:33.829; most accessible tissue: Callus, score: 65.349 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129130509 6.98E-06 6.98E-06 mr1162 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129130509 9.73E-06 9.73E-06 mr1429 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129130509 1.50E-06 1.50E-06 mr1452 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129130509 7.81E-06 7.81E-06 mr1513 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129130509 1.99E-06 2.25E-06 mr1590 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129130509 5.83E-06 5.83E-06 mr1964 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251