\
| Variant ID: vg0129130509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29130509 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 128. )
ATGTTAGAATTGAGGAGATGGCTATGTTTTTAAATAATTTGTGGCAAAAGTACAATTTTACCCCTACACGTCTATATTTTTATGGATAATCATACCTCTT[C/A]
ATATTTCTACTATTGTTAAATAAGGTTATAGTATAAAAAGATCTGAACTCTCAAATAAAATTAGATTTGTGGTTCAGATCGATTAACTTCTACTACTAGT
ACTAGTAGTAGAAGTTAATCGATCTGAACCACAAATCTAATTTTATTTGAGAGTTCAGATCTTTTTATACTATAACCTTATTTAACAATAGTAGAAATAT[G/T]
AAGAGGTATGATTATCCATAAAAATATAGACGTGTAGGGGTAAAATTGTACTTTTGCCACAAATTATTTAAAAACATAGCCATCTCCTCAATTCTAACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 5.30% | 1.12% | 0.00% | NA |
| All Indica | 2759 | 89.30% | 8.90% | 1.81% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.10% | 0.70% | 3.19% | 0.00% | NA |
| Indica II | 465 | 86.20% | 11.40% | 2.37% | 0.00% | NA |
| Indica III | 913 | 83.90% | 15.30% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 6.10% | 1.65% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129130509 | C -> A | LOC_Os01g50710.1 | upstream_gene_variant ; 420.0bp to feature; MODIFIER | silent_mutation | Average:33.829; most accessible tissue: Callus, score: 65.349 | N | N | N | N |
| vg0129130509 | C -> A | LOC_Os01g50720.1 | downstream_gene_variant ; 1650.0bp to feature; MODIFIER | silent_mutation | Average:33.829; most accessible tissue: Callus, score: 65.349 | N | N | N | N |
| vg0129130509 | C -> A | LOC_Os01g50700-LOC_Os01g50710 | intergenic_region ; MODIFIER | silent_mutation | Average:33.829; most accessible tissue: Callus, score: 65.349 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129130509 | 6.98E-06 | 6.98E-06 | mr1162 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129130509 | 9.73E-06 | 9.73E-06 | mr1429 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129130509 | 1.50E-06 | 1.50E-06 | mr1452 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129130509 | 7.81E-06 | 7.81E-06 | mr1513 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129130509 | 1.99E-06 | 2.25E-06 | mr1590 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129130509 | 5.83E-06 | 5.83E-06 | mr1964 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |