Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0129128111:

Variant ID: vg0129128111 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29128111
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAAACAAGTTTTAGTCAAAAAAAAATTCTCAAACAAATCACTCATCTTGTTTTTTTTTTCAAATCACATAAGCACAGTGGTGGAGTCAGGATAAAATTA[T/G]
AGCGGGGCTAAACTAAAGTGGAAAATAAAAATTGAAATATGTCTCATATAAATTGGCTATATTTCTAATACAAAATATAAATATATGGATTAGAATTTTA

Reverse complement sequence

TAAAATTCTAATCCATATATTTATATTTTGTATTAGAAATATAGCCAATTTATATGAGACATATTTCAATTTTTATTTTCCACTTTAGTTTAGCCCCGCT[A/C]
TAATTTTATCCTGACTCCACCACTGTGCTTATGTGATTTGAAAAAAAAAACAAGATGAGTGATTTGTTTGAGAATTTTTTTTTGACTAAAACTTGTTTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 98.60% 1.40% 0.04% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 95.90% 4.00% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 95.30% 4.40% 0.26% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129128111 T -> G LOC_Os01g50710.1 upstream_gene_variant ; 2818.0bp to feature; MODIFIER silent_mutation Average:50.924; most accessible tissue: Minghui63 flower, score: 77.232 N N N N
vg0129128111 T -> G LOC_Os01g50700.1 downstream_gene_variant ; 3475.0bp to feature; MODIFIER silent_mutation Average:50.924; most accessible tissue: Minghui63 flower, score: 77.232 N N N N
vg0129128111 T -> G LOC_Os01g50720.1 downstream_gene_variant ; 4048.0bp to feature; MODIFIER silent_mutation Average:50.924; most accessible tissue: Minghui63 flower, score: 77.232 N N N N
vg0129128111 T -> G LOC_Os01g50700-LOC_Os01g50710 intergenic_region ; MODIFIER silent_mutation Average:50.924; most accessible tissue: Minghui63 flower, score: 77.232 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129128111 NA 7.27E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129128111 4.20E-07 2.94E-11 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129128111 1.87E-06 4.81E-11 mr1757_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251