RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0129100356:

Variant ID: vg0129100356 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29100356
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )

Flanking Sequence (100 bp) in Reference Genome:

CCCAAACCACAACAACTTTTCACAAAGCACAGGCAAACAAATCTACGCTACAGGAAACACCTCACATCCGCCCATGACCGTGGGCACGGCTGTTCGAACA[G/A]
TTAGTTAACCTCTGCAGAGGAGGTACACTTTACCCACACGACATTACTAACCTGGATCACCCAGCCGGAGACCCTAAGGCCGAGATAACGGGCCGGCCAG

Reverse complement sequence

CTGGCCGGCCCGTTATCTCGGCCTTAGGGTCTCCGGCTGGGTGATCCAGGTTAGTAATGTCGTGTGGGTAAAGTGTACCTCCTCTGCAGAGGTTAACTAA[C/T]
TGTTCGAACAGCCGTGCCCACGGTCATGGGCGGATGTGAGGTGTTTCCTGTAGCGTAGATTTGTTTGCCTGTGCTTTGTGAAAAGTTGTTGTGGTTTGGG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.50%	7.70%	0.76%	0.00%	NA
All Indica	2759	99.30%	0.70%	0.04%	0.00%	NA
All Japonica	1512	76.30%	21.50%	2.18%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.10%	0.13%	0.00%	NA
Temperate Japonica	767	91.80%	5.90%	2.35%	0.00%	NA
Tropical Japonica	504	61.50%	37.30%	1.19%	0.00%	NA
Japonica Intermediate	241	58.10%	38.20%	3.73%	0.00%	NA
VI/Aromatic	96	90.60%	9.40%	0.00%	0.00%	NA
Intermediate	90	85.60%	12.20%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129100356	G -> A	LOC_Os01g50660.1	upstream_gene_variant ; 4330.0bp to feature; MODIFIER	silent_mutation	Average:56.766; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg0129100356	G -> A	LOC_Os01g50670.1	upstream_gene_variant ; 295.0bp to feature; MODIFIER	silent_mutation	Average:56.766; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg0129100356	G -> A	LOC_Os01g50680.1	upstream_gene_variant ; 4528.0bp to feature; MODIFIER	silent_mutation	Average:56.766; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N
vg0129100356	G -> A	LOC_Os01g50660-LOC_Os01g50670	intergenic_region ; MODIFIER	silent_mutation	Average:56.766; most accessible tissue: Minghui63 young leaf, score: 70.655	N	N	N	N

Showing 1 to 4 of 4 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129100356	7.68E-07	7.68E-07	mr1160	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129100356	7.39E-07	NA	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0129100356:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact