\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129100082:

Variant ID: vg0129100082 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29100082
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGAGATGTTTTTCAACAGCTCATTTGGTAATGTACCGACCTCCCGGTTCAGATCATTACTTCTCGGCTCCCAGAGCCATTTCACTTGATTAATCGGCTCC[C/T]
AAAGCCTTTTCATTTTCTCGGACTCCCAGAGTCCAGCTGCCCAGCAGCACAACAATCCGCTTCCACTCAGGAAGCCTAGTCTATGATGCCCGTAGACATC

Reverse complement sequence

GATGTCTACGGGCATCATAGACTAGGCTTCCTGAGTGGAAGCGGATTGTTGTGCTGCTGGGCAGCTGGACTCTGGGAGTCCGAGAAAATGAAAAGGCTTT[G/A]
GGAGCCGATTAATCAAGTGAAATGGCTCTGGGAGCCGAGAAGTAATGATCTGAACCGGGAGGTCGGTACATTACCAAATGAGCTGTTGAAAAACATCTCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 5.20% 1.61% 0.00% NA
All Indica  2759 88.70% 8.80% 2.57% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 94.80% 0.80% 4.37% 0.00% NA
Indica II  465 86.20% 10.50% 3.23% 0.00% NA
Indica III  913 83.90% 15.70% 0.44% 0.00% NA
Indica Intermediate  786 91.00% 5.70% 3.31% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 0.00% 2.08% 0.00% NA
Intermediate  90 93.30% 3.30% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129100082 C -> T LOC_Os01g50660.1 upstream_gene_variant ; 4056.0bp to feature; MODIFIER silent_mutation Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 N N N N
vg0129100082 C -> T LOC_Os01g50670.1 upstream_gene_variant ; 569.0bp to feature; MODIFIER silent_mutation Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 N N N N
vg0129100082 C -> T LOC_Os01g50680.1 upstream_gene_variant ; 4802.0bp to feature; MODIFIER silent_mutation Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 N N N N
vg0129100082 C -> T LOC_Os01g50660-LOC_Os01g50670 intergenic_region ; MODIFIER silent_mutation Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129100082 2.43E-06 2.43E-06 mr1452 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129100082 7.31E-07 1.53E-06 mr1590 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129100082 9.93E-06 NA mr1630 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129100082 7.71E-06 7.71E-06 mr1964 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251