\
| Variant ID: vg0129100082 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 29100082 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGAGATGTTTTTCAACAGCTCATTTGGTAATGTACCGACCTCCCGGTTCAGATCATTACTTCTCGGCTCCCAGAGCCATTTCACTTGATTAATCGGCTCC[C/T]
AAAGCCTTTTCATTTTCTCGGACTCCCAGAGTCCAGCTGCCCAGCAGCACAACAATCCGCTTCCACTCAGGAAGCCTAGTCTATGATGCCCGTAGACATC
GATGTCTACGGGCATCATAGACTAGGCTTCCTGAGTGGAAGCGGATTGTTGTGCTGCTGGGCAGCTGGACTCTGGGAGTCCGAGAAAATGAAAAGGCTTT[G/A]
GGAGCCGATTAATCAAGTGAAATGGCTCTGGGAGCCGAGAAGTAATGATCTGAACCGGGAGGTCGGTACATTACCAAATGAGCTGTTGAAAAACATCTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 5.20% | 1.61% | 0.00% | NA |
| All Indica | 2759 | 88.70% | 8.80% | 2.57% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.80% | 0.80% | 4.37% | 0.00% | NA |
| Indica II | 465 | 86.20% | 10.50% | 3.23% | 0.00% | NA |
| Indica III | 913 | 83.90% | 15.70% | 0.44% | 0.00% | NA |
| Indica Intermediate | 786 | 91.00% | 5.70% | 3.31% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0129100082 | C -> T | LOC_Os01g50660.1 | upstream_gene_variant ; 4056.0bp to feature; MODIFIER | silent_mutation | Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| vg0129100082 | C -> T | LOC_Os01g50670.1 | upstream_gene_variant ; 569.0bp to feature; MODIFIER | silent_mutation | Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| vg0129100082 | C -> T | LOC_Os01g50680.1 | upstream_gene_variant ; 4802.0bp to feature; MODIFIER | silent_mutation | Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| vg0129100082 | C -> T | LOC_Os01g50660-LOC_Os01g50670 | intergenic_region ; MODIFIER | silent_mutation | Average:29.881; most accessible tissue: Minghui63 flower, score: 42.268 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0129100082 | 2.43E-06 | 2.43E-06 | mr1452 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129100082 | 7.31E-07 | 1.53E-06 | mr1590 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129100082 | 9.93E-06 | NA | mr1630 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0129100082 | 7.71E-06 | 7.71E-06 | mr1964 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |