\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129095966:

Variant ID: vg0129095966 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 29095966
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


TCATTGTATGAAGAAGGGCAGACGTGTAGCATGCTGAACTGACACGTGGTGGACAAGAATGACCGGTCTGTGACTGGTCTGACGCCGGTCGCGTCATCGG[C/T]
AGACAACCGTGCTCCCGCGATGCATCTGCCTCCGATGGAGTGGAGGTAGGTATGACCCATCTCGTCGGATGGTCATTTGGAAAGCAGCCATGGCAAATCT

Reverse complement sequence

AGATTTGCCATGGCTGCTTTCCAAATGACCATCCGACGAGATGGGTCATACCTACCTCCACTCCATCGGAGGCAGATGCATCGCGGGAGCACGGTTGTCT[G/A]
CCGATGACGCGACCGGCGTCAGACCAGTCACAGACCGGTCATTCTTGTCCACCACGTGTCAGTTCAGCATGCTACACGTCTGCCCTTCTTCATACAATGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 17.10% 12.20% 0.17% 70.55% NA
All Indica  2759 0.70% 0.90% 0.18% 98.22% NA
All Japonica  1512 50.80% 33.90% 0.07% 15.21% NA
Aus  269 0.40% 4.50% 0.00% 95.17% NA
Indica I  595 1.20% 0.20% 0.17% 98.49% NA
Indica II  465 0.90% 1.90% 0.00% 97.20% NA
Indica III  913 0.10% 0.10% 0.22% 99.56% NA
Indica Intermediate  786 0.80% 1.90% 0.25% 97.07% NA
Temperate Japonica  767 87.70% 12.00% 0.00% 0.26% NA
Tropical Japonica  504 2.20% 55.60% 0.20% 42.06% NA
Japonica Intermediate  241 34.90% 58.50% 0.00% 6.64% NA
VI/Aromatic  96 0.00% 9.40% 1.04% 89.58% NA
Intermediate  90 23.30% 17.80% 1.11% 57.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0129095966 C -> T LOC_Os01g50660.1 missense_variant ; p.Ala21Thr; MODERATE nonsynonymous_codon ; A21T Average:7.094; most accessible tissue: Callus, score: 28.491 possibly damaging 1.571 DELETERIOUS 0.02
vg0129095966 C -> DEL LOC_Os01g50660.1 N frameshift_variant Average:7.094; most accessible tissue: Callus, score: 28.491 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0129095966 NA 2.27E-06 mr1119 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 7.36E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 1.92E-07 mr1064_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 5.12E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 4.20E-06 mr1278_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 6.35E-08 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 3.57E-06 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 2.25E-06 1.98E-10 mr1369_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 5.73E-06 mr1374_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 5.97E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 6.35E-07 1.50E-11 mr1453_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 4.25E-06 mr1467_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 2.62E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 1.78E-06 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 1.39E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 7.42E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 5.34E-07 mr1556_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 5.08E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 5.80E-06 mr1652_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 5.46E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 1.88E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 1.15E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 2.38E-07 mr1764_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 1.42E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 4.36E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 8.48E-06 mr1923_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 7.95E-07 mr1929_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966 NA 1.40E-06 mr1984_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251