Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129095966:

Variant ID: vg0129095966 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29095966
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

TCATTGTATGAAGAAGGGCAGACGTGTAGCATGCTGAACTGACACGTGGTGGACAAGAATGACCGGTCTGTGACTGGTCTGACGCCGGTCGCGTCATCGG[C/T]
AGACAACCGTGCTCCCGCGATGCATCTGCCTCCGATGGAGTGGAGGTAGGTATGACCCATCTCGTCGGATGGTCATTTGGAAAGCAGCCATGGCAAATCT

Reverse complement sequence

AGATTTGCCATGGCTGCTTTCCAAATGACCATCCGACGAGATGGGTCATACCTACCTCCACTCCATCGGAGGCAGATGCATCGCGGGAGCACGGTTGTCT[G/A]
CCGATGACGCGACCGGCGTCAGACCAGTCACAGACCGGTCATTCTTGTCCACCACGTGTCAGTTCAGCATGCTACACGTCTGCCCTTCTTCATACAATGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	17.10%	12.20%	0.17%	70.55%	NA
All Indica	2759	0.70%	0.90%	0.18%	98.22%	NA
All Japonica	1512	50.80%	33.90%	0.07%	15.21%	NA
Aus	269	0.40%	4.50%	0.00%	95.17%	NA
Indica I	595	1.20%	0.20%	0.17%	98.49%	NA
Indica II	465	0.90%	1.90%	0.00%	97.20%	NA
Indica III	913	0.10%	0.10%	0.22%	99.56%	NA
Indica Intermediate	786	0.80%	1.90%	0.25%	97.07%	NA
Temperate Japonica	767	87.70%	12.00%	0.00%	0.26%	NA
Tropical Japonica	504	2.20%	55.60%	0.20%	42.06%	NA
Japonica Intermediate	241	34.90%	58.50%	0.00%	6.64%	NA
VI/Aromatic	96	0.00%	9.40%	1.04%	89.58%	NA
Intermediate	90	23.30%	17.80%	1.11%	57.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129095966	C -> T	LOC_Os01g50660.1	missense_variant ; p.Ala21Thr; MODERATE	nonsynonymous_codon ; A21T	Average:7.094; most accessible tissue: Callus, score: 28.491	possibly damaging	1.571	DELETERIOUS	0.02
vg0129095966	C -> DEL	LOC_Os01g50660.1	N	frameshift_variant	Average:7.094; most accessible tissue: Callus, score: 28.491	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129095966	NA	2.27E-06	mr1119	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	7.36E-06	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	1.92E-07	mr1064_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	5.12E-06	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	4.20E-06	mr1278_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	6.35E-08	mr1289_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	3.57E-06	mr1293_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	2.25E-06	1.98E-10	mr1369_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	5.73E-06	mr1374_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	5.97E-06	mr1419_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	6.35E-07	1.50E-11	mr1453_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	4.25E-06	mr1467_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	2.62E-06	mr1470_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	1.78E-06	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	1.39E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	7.42E-07	mr1524_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	5.34E-07	mr1556_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	5.08E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	5.80E-06	mr1652_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	5.46E-07	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	1.88E-08	mr1683_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	1.15E-06	mr1687_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	2.38E-07	mr1764_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	1.42E-06	mr1812_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	4.36E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	8.48E-06	mr1923_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	7.95E-07	mr1929_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129095966	NA	1.40E-06	mr1984_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251