RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0129059051:

Variant ID: vg0129059051 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29059051
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTTATTTTGTTATGAGTTGTTTTATCACTTATAGTATTTTAAGTGTGATTTATATCTTATATATTTGTATAAAATTTTTGAATAAGACGAATGGTTAAA[T/C]
ATGTGAGAAAAAGTTAATGGCGTCATCTATTAAAAAACTAAAGGATTATATGCTAATGACTTAGGAGTACATCGCTTTTCATGCAGCTAACTAGCTAATC

Reverse complement sequence

GATTAGCTAGTTAGCTGCATGAAAAGCGATGTACTCCTAAGTCATTAGCATATAATCCTTTAGTTTTTTAATAGATGACGCCATTAACTTTTTCTCACAT[A/G]
TTTAACCATTCGTCTTATTCAAAAATTTTATACAAATATATAAGATATAAATCACACTTAAAATACTATAAGTGATAAAACAACTCATAACAAAATAAAT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.40%	14.50%	0.15%	0.00%	NA
All Indica	2759	97.90%	2.00%	0.04%	0.00%	NA
All Japonica	1512	61.60%	38.40%	0.07%	0.00%	NA
Aus	269	91.80%	7.10%	1.12%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	97.00%	3.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.30%	2.50%	0.13%	0.00%	NA
Temperate Japonica	767	88.40%	11.60%	0.00%	0.00%	NA
Tropical Japonica	504	32.10%	67.70%	0.20%	0.00%	NA
Japonica Intermediate	241	37.80%	62.20%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	80.00%	17.80%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129059051	T -> C	LOC_Os01g50610-LOC_Os01g50616	intergenic_region ; MODIFIER	silent_mutation	Average:41.555; most accessible tissue: Callus, score: 70.622	N	N	N	N

Showing 1 to 1 of 1 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129059051	7.81E-06	7.81E-06	mr1160	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	1.62E-06	NA	mr1679	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	9.97E-09	mr1693	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	9.01E-20	mr1042_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	4.73E-07	mr1369_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	7.08E-08	mr1453_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	1.59E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	3.42E-10	mr1680_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	2.59E-07	mr1691_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129059051	NA	4.31E-22	mr1871_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 11 entries

Previous1 2Next

Search for Variation information by Variation ID:

Detailed information for vg0129059051:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact