Variant ID: vg0129059051 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 29059051 |
Reference Allele: T | Alternative Allele: C |
Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ATTTATTTTGTTATGAGTTGTTTTATCACTTATAGTATTTTAAGTGTGATTTATATCTTATATATTTGTATAAAATTTTTGAATAAGACGAATGGTTAAA[T/C]
ATGTGAGAAAAAGTTAATGGCGTCATCTATTAAAAAACTAAAGGATTATATGCTAATGACTTAGGAGTACATCGCTTTTCATGCAGCTAACTAGCTAATC
GATTAGCTAGTTAGCTGCATGAAAAGCGATGTACTCCTAAGTCATTAGCATATAATCCTTTAGTTTTTTAATAGATGACGCCATTAACTTTTTCTCACAT[A/G]
TTTAACCATTCGTCTTATTCAAAAATTTTATACAAATATATAAGATATAAATCACACTTAAAATACTATAAGTGATAAAACAACTCATAACAAAATAAAT
Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 85.40% | 14.50% | 0.15% | 0.00% | NA |
All Indica | 2759 | 97.90% | 2.00% | 0.04% | 0.00% | NA |
All Japonica | 1512 | 61.60% | 38.40% | 0.07% | 0.00% | NA |
Aus | 269 | 91.80% | 7.10% | 1.12% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 97.30% | 2.50% | 0.13% | 0.00% | NA |
Temperate Japonica | 767 | 88.40% | 11.60% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 32.10% | 67.70% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 37.80% | 62.20% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
Intermediate | 90 | 80.00% | 17.80% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0129059051 | T -> C | LOC_Os01g50610-LOC_Os01g50616 | intergenic_region ; MODIFIER | silent_mutation | Average:41.555; most accessible tissue: Callus, score: 70.622 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0129059051 | 7.81E-06 | 7.81E-06 | mr1160 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | 1.62E-06 | NA | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 9.97E-09 | mr1693 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 9.01E-20 | mr1042_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 4.73E-07 | mr1369_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 7.08E-08 | mr1453_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 1.59E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 3.42E-10 | mr1680_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 2.59E-07 | mr1691_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0129059051 | NA | 4.31E-22 | mr1871_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/