\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128909956:

Variant ID: vg0128909956 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28909956
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AATGAGAGGAAAGCTTATGGGCCTGTTCACTCTGATGTCATTTTCAATCTTACTAAATTTTGATAAAGTTGTAAAAAAAGTGGCTACATTTAGTTTGCTG[C/T]
CAAATTTTGGTAACTATATAAGAAATCCTGTCAATTTTGGTAACTATGCTGATAAGGTTTTTTTTTCATCCAAGTGAATAGGCCCTATGTATTGACATGT

Reverse complement sequence

ACATGTCAATACATAGGGCCTATTCACTTGGATGAAAAAAAAACCTTATCAGCATAGTTACCAAAATTGACAGGATTTCTTATATAGTTACCAAAATTTG[G/A]
CAGCAAACTAAATGTAGCCACTTTTTTTACAACTTTATCAAAATTTAGTAAGATTGAAAATGACATCAGAGTGAACAGGCCCATAAGCTTTCCTCTCATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 36.90% 1.16% 0.00% NA
All Indica  2759 91.90% 6.20% 1.92% 0.00% NA
All Japonica  1512 16.10% 83.90% 0.00% 0.00% NA
Aus  269 10.80% 88.50% 0.74% 0.00% NA
Indica I  595 80.00% 12.10% 7.90% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 97.50% 2.50% 0.00% 0.00% NA
Indica Intermediate  786 91.50% 7.80% 0.76% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 44.40% 55.60% 0.00% 0.00% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 51.10% 48.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128909956 C -> T LOC_Os01g50360.1 upstream_gene_variant ; 3419.0bp to feature; MODIFIER silent_mutation Average:55.036; most accessible tissue: Callus, score: 76.2 N N N N
vg0128909956 C -> T LOC_Os01g50350.2 downstream_gene_variant ; 257.0bp to feature; MODIFIER silent_mutation Average:55.036; most accessible tissue: Callus, score: 76.2 N N N N
vg0128909956 C -> T LOC_Os01g50350.1 downstream_gene_variant ; 257.0bp to feature; MODIFIER silent_mutation Average:55.036; most accessible tissue: Callus, score: 76.2 N N N N
vg0128909956 C -> T LOC_Os01g50340-LOC_Os01g50350 intergenic_region ; MODIFIER silent_mutation Average:55.036; most accessible tissue: Callus, score: 76.2 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128909956 NA 5.45E-07 mr1157 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 4.30E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 1.91E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 3.53E-18 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 6.29E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 5.84E-09 mr1174_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 7.11E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 1.46E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 5.35E-06 mr1571_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 6.03E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 6.43E-06 mr1671_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 2.98E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 4.90E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128909956 NA 8.86E-19 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251