\
| Variant ID: vg0128909956 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28909956 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.70, T: 0.30, others allele: 0.00, population size: 105. )
AATGAGAGGAAAGCTTATGGGCCTGTTCACTCTGATGTCATTTTCAATCTTACTAAATTTTGATAAAGTTGTAAAAAAAGTGGCTACATTTAGTTTGCTG[C/T]
CAAATTTTGGTAACTATATAAGAAATCCTGTCAATTTTGGTAACTATGCTGATAAGGTTTTTTTTTCATCCAAGTGAATAGGCCCTATGTATTGACATGT
ACATGTCAATACATAGGGCCTATTCACTTGGATGAAAAAAAAACCTTATCAGCATAGTTACCAAAATTGACAGGATTTCTTATATAGTTACCAAAATTTG[G/A]
CAGCAAACTAAATGTAGCCACTTTTTTTACAACTTTATCAAAATTTAGTAAGATTGAAAATGACATCAGAGTGAACAGGCCCATAAGCTTTCCTCTCATT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.90% | 36.90% | 1.16% | 0.00% | NA |
| All Indica | 2759 | 91.90% | 6.20% | 1.92% | 0.00% | NA |
| All Japonica | 1512 | 16.10% | 83.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.80% | 88.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 80.00% | 12.10% | 7.90% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.50% | 2.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 91.50% | 7.80% | 0.76% | 0.00% | NA |
| Temperate Japonica | 767 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 44.40% | 55.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 48.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128909956 | C -> T | LOC_Os01g50360.1 | upstream_gene_variant ; 3419.0bp to feature; MODIFIER | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 76.2 | N | N | N | N |
| vg0128909956 | C -> T | LOC_Os01g50350.2 | downstream_gene_variant ; 257.0bp to feature; MODIFIER | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 76.2 | N | N | N | N |
| vg0128909956 | C -> T | LOC_Os01g50350.1 | downstream_gene_variant ; 257.0bp to feature; MODIFIER | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 76.2 | N | N | N | N |
| vg0128909956 | C -> T | LOC_Os01g50340-LOC_Os01g50350 | intergenic_region ; MODIFIER | silent_mutation | Average:55.036; most accessible tissue: Callus, score: 76.2 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128909956 | NA | 5.45E-07 | mr1157 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 4.30E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 1.91E-09 | mr1746 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 3.53E-18 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 6.29E-11 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 5.84E-09 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 7.11E-20 | mr1183_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 1.46E-10 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 5.35E-06 | mr1571_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 6.03E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 6.43E-06 | mr1671_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 2.98E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 4.90E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128909956 | NA | 8.86E-19 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |