Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128900932:

Variant ID: vg0128900932 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28900932
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.01, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:

ATTACAATTAAAGTATAAATTTTGTCTAAACACAATTTACAGATGAAAATGAATGTACTACATCTTTGATCCTTTGTAGATTGTATGGGAGCCAGGGTTT[C/T]
ACTTATCGCACGATAATCGCGCGACAAAAATCATGGATGTAGTTCTTGATTTGTAATTGCCAATGGTGAAGAATTTTTTTGAAATAGAGTAAGCTAAATT

Reverse complement sequence

AATTTAGCTTACTCTATTTCAAAAAAATTCTTCACCATTGGCAATTACAAATCAAGAACTACATCCATGATTTTTGTCGCGCGATTATCGTGCGATAAGT[G/A]
AAACCCTGGCTCCCATACAATCTACAAAGGATCAAAGATGTAGTACATTCATTTTCATCTGTAAATTGTGTTTAGACAAAATTTATACTTTAATTGTAAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.80%	11.20%	0.02%	0.00%	NA
All Indica	2759	89.50%	10.40%	0.04%	0.00%	NA
All Japonica	1512	99.80%	0.20%	0.00%	0.00%	NA
Aus	269	19.30%	80.70%	0.00%	0.00%	NA
Indica I	595	93.90%	6.10%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	83.00%	16.90%	0.11%	0.00%	NA
Indica Intermediate	786	87.70%	12.30%	0.00%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128900932	C -> T	LOC_Os01g50340.1	downstream_gene_variant ; 3658.0bp to feature; MODIFIER	silent_mutation	Average:43.267; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N
vg0128900932	C -> T	LOC_Os01g50340-LOC_Os01g50350	intergenic_region ; MODIFIER	silent_mutation	Average:43.267; most accessible tissue: Minghui63 panicle, score: 73.225	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128900932	NA	1.71E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	5.03E-06	mr1045_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	7.78E-06	mr1060_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	2.00E-13	mr1193_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	8.43E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	2.34E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	5.46E-07	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	1.16E-09	mr1388_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	2.14E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	1.68E-06	7.35E-10	mr1511_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	9.43E-07	2.54E-07	mr1511_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	1.47E-06	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	4.93E-07	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128900932	NA	1.77E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251