\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128869874:

Variant ID: vg0128869874 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28869874
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCTTTGTGTTGATTGTATGGGTCGGGTTTTGGGTGATCTCGGCAGTGTTCTGTTGTTGGCCTAGCGGCGGTCGGTCACGCTTAGCGGCGGCTGGTCCG[G/A]
TGCTAGCCTTCTCCTGGATCTGTGTGTTGGCACTGTCGGTGTGTGGGTGGTGGTATAATTTTCTTTTTTCCTGGTTACGACCTTCCAAGGTTGAAATCTT

Reverse complement sequence

AAGATTTCAACCTTGGAAGGTCGTAACCAGGAAAAAAGAAAATTATACCACCACCCACACACCGACAGTGCCAACACACAGATCCAGGAGAAGGCTAGCA[C/T]
CGGACCAGCCGCCGCTAAGCGTGACCGACCGCCGCTAGGCCAACAACAGAACACTGCCGAGATCACCCAAAACCCGACCCATACAATCAACACAAAGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.50% 44.40% 0.38% 0.72% NA
All Indica  2759 84.70% 14.30% 0.47% 0.54% NA
All Japonica  1512 7.90% 91.50% 0.20% 0.40% NA
Aus  269 9.30% 90.00% 0.00% 0.74% NA
Indica I  595 92.10% 6.70% 1.01% 0.17% NA
Indica II  465 96.30% 3.40% 0.00% 0.22% NA
Indica III  913 74.90% 23.90% 0.11% 1.10% NA
Indica Intermediate  786 83.50% 15.40% 0.76% 0.38% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 21.20% 77.00% 0.60% 1.19% NA
Japonica Intermediate  241 3.70% 96.30% 0.00% 0.00% NA
VI/Aromatic  96 64.60% 27.10% 0.00% 8.33% NA
Intermediate  90 37.80% 56.70% 2.22% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128869874 G -> A LOC_Os01g50240.1 upstream_gene_variant ; 3367.0bp to feature; MODIFIER silent_mutation Average:71.789; most accessible tissue: Minghui63 flower, score: 91.425 N N N N
vg0128869874 G -> A LOC_Os01g50259.1 downstream_gene_variant ; 443.0bp to feature; MODIFIER silent_mutation Average:71.789; most accessible tissue: Minghui63 flower, score: 91.425 N N N N
vg0128869874 G -> A LOC_Os01g50280.1 downstream_gene_variant ; 4665.0bp to feature; MODIFIER silent_mutation Average:71.789; most accessible tissue: Minghui63 flower, score: 91.425 N N N N
vg0128869874 G -> A LOC_Os01g50240-LOC_Os01g50259 intergenic_region ; MODIFIER silent_mutation Average:71.789; most accessible tissue: Minghui63 flower, score: 91.425 N N N N
vg0128869874 G -> DEL N N silent_mutation Average:71.789; most accessible tissue: Minghui63 flower, score: 91.425 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128869874 G A -0.03 -0.02 -0.02 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128869874 NA 2.88E-06 mr1011 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 5.81E-07 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 7.36E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 1.28E-17 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 2.35E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 3.84E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 1.67E-17 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 1.42E-07 mr1060_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 1.86E-07 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 5.52E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 3.75E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 3.98E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 1.38E-24 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 3.84E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 3.79E-07 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 7.47E-06 mr1511_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 1.90E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 1.34E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 2.30E-18 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 2.51E-06 mr1834_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 8.03E-06 2.74E-08 mr1954_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128869874 NA 8.38E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251