\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128867188:

Variant ID: vg0128867188 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28867188
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAAACTTTCAATTTTAGCGTGAACTAAACATACCCTAGAATGTTTACTGATGCCAATCTAGCTATCCAATAAAGGCTGTGTTTATTTCACACTAAAATT[A/G]
GAAGTTTGGATCAAATTGAGACGATGTGACGGAAAAGTTAGAAGTTTGTGTGTGTAGGAAAGTTTTGATGTGATGAAAAAGTTAAAAGTTTGAAGAAAAA

Reverse complement sequence

TTTTTCTTCAAACTTTTAACTTTTTCATCACATCAAAACTTTCCTACACACACAAACTTCTAACTTTTCCGTCACATCGTCTCAATTTGATCCAAACTTC[T/C]
AATTTTAGTGTGAAATAAACACAGCCTTTATTGGATAGCTAGATTGGCATCAGTAAACATTCTAGGGTATGTTTAGTTCACGCTAAAATTGAAAGTTTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.10% 12.80% 0.15% 0.00% NA
All Indica  2759 87.00% 12.80% 0.18% 0.00% NA
All Japonica  1512 99.60% 0.30% 0.13% 0.00% NA
Aus  269 17.10% 82.90% 0.00% 0.00% NA
Indica I  595 93.90% 6.10% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 76.10% 23.50% 0.33% 0.00% NA
Indica Intermediate  786 87.00% 12.70% 0.25% 0.00% NA
Temperate Japonica  767 99.60% 0.10% 0.26% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128867188 A -> G LOC_Os01g50230.1 upstream_gene_variant ; 4221.0bp to feature; MODIFIER silent_mutation Average:43.907; most accessible tissue: Callus, score: 83.263 N N N N
vg0128867188 A -> G LOC_Os01g50240.1 upstream_gene_variant ; 681.0bp to feature; MODIFIER silent_mutation Average:43.907; most accessible tissue: Callus, score: 83.263 N N N N
vg0128867188 A -> G LOC_Os01g50259.1 downstream_gene_variant ; 3129.0bp to feature; MODIFIER silent_mutation Average:43.907; most accessible tissue: Callus, score: 83.263 N N N N
vg0128867188 A -> G LOC_Os01g50240-LOC_Os01g50259 intergenic_region ; MODIFIER silent_mutation Average:43.907; most accessible tissue: Callus, score: 83.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128867188 NA 2.25E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 1.93E-06 mr1060_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 2.75E-12 mr1193_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 3.58E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 6.53E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 8.90E-06 4.74E-07 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 8.69E-10 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 2.43E-06 mr1474_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 2.07E-08 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 1.92E-09 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 6.26E-06 1.38E-06 mr1511_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 2.13E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 5.56E-06 mr1836_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 5.70E-06 mr1954_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128867188 NA 9.98E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251