Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128866915:

Variant ID: vg0128866915 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28866915
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

TCTTATTTGACGAGCCGAGTTTAGATACAAAGTTTCTCTTCGAACTTCAGGTGTGTGTAGTTAACGTTAAAATTGAAAGTTTGGTTAAAATTAAAACGAT[G/A]
TGACGGAAAAGTTGGAAGTTTGTCTGTGTAGAAAAATTTTGATGTGATGGAAAAGTTAGAAGTTTGAAGAAATATTTTGCAACTAAACACGGCCTTCTAA

Reverse complement sequence

TTAGAAGGCCGTGTTTAGTTGCAAAATATTTCTTCAAACTTCTAACTTTTCCATCACATCAAAATTTTTCTACACAGACAAACTTCCAACTTTTCCGTCA[C/T]
ATCGTTTTAATTTTAACCAAACTTTCAATTTTAACGTTAACTACACACACCTGAAGTTCGAAGAGAAACTTTGTATCTAAACTCGGCTCGTCAAATAAGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.40%	44.50%	0.06%	0.00%	NA
All Indica	2759	85.40%	14.50%	0.04%	0.00%	NA
All Japonica	1512	8.40%	91.50%	0.07%	0.00%	NA
Aus	269	10.00%	90.00%	0.00%	0.00%	NA
Indica I	595	93.90%	6.10%	0.00%	0.00%	NA
Indica II	465	96.10%	3.90%	0.00%	0.00%	NA
Indica III	913	75.60%	24.40%	0.00%	0.00%	NA
Indica Intermediate	786	84.10%	15.80%	0.13%	0.00%	NA
Temperate Japonica	767	0.40%	99.50%	0.13%	0.00%	NA
Tropical Japonica	504	22.80%	77.20%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	72.90%	27.10%	0.00%	0.00%	NA
Intermediate	90	42.20%	56.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128866915	G -> A	LOC_Os01g50230.1	upstream_gene_variant ; 3948.0bp to feature; MODIFIER	silent_mutation	Average:49.027; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0128866915	G -> A	LOC_Os01g50240.1	upstream_gene_variant ; 408.0bp to feature; MODIFIER	silent_mutation	Average:49.027; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0128866915	G -> A	LOC_Os01g50259.1	downstream_gene_variant ; 3402.0bp to feature; MODIFIER	silent_mutation	Average:49.027; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N
vg0128866915	G -> A	LOC_Os01g50240-LOC_Os01g50259	intergenic_region ; MODIFIER	silent_mutation	Average:49.027; most accessible tissue: Minghui63 panicle, score: 82.128	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128866915	NA	2.66E-34	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	3.98E-16	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	2.51E-19	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	3.22E-17	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	5.10E-31	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	3.37E-31	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	1.76E-19	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	2.52E-07	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	1.77E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	4.92E-07	mr1302_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	5.24E-06	mr1358_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	7.96E-06	1.78E-06	mr1381_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	3.31E-25	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	7.69E-07	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	1.85E-06	NA	mr1511_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	7.93E-06	1.21E-06	mr1511_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	1.90E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	8.83E-06	mr1702_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	1.12E-18	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	8.78E-07	mr1824_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	4.72E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	3.57E-07	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	9.47E-07	mr1954_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128866915	NA	1.93E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251