Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128839134:

Variant ID: vg0128839134 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28839134
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.83, T: 0.17, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCAACCAAAAAACCAATTACAATTGGTCCCTCAACTATCAAAACCAGTGCAGATGAGGTCCCTCAGCGGTTTGGATGGTGGTTTTGGCTGACGTGGCG[T/C]
CTTCGTAGCTAATTTGACTTTGTCTTTATTTGACGTAGCATTGACATGGCGCTTACGTGGCAATGTGAGCTGGAAAATAATAAATCTCGTGGGACCCACA

Reverse complement sequence

TGTGGGTCCCACGAGATTTATTATTTTCCAGCTCACATTGCCACGTAAGCGCCATGTCAATGCTACGTCAAATAAAGACAAAGTCAAATTAGCTACGAAG[A/G]
CGCCACGTCAGCCAAAACCACCATCCAAACCGCTGAGGGACCTCATCTGCACTGGTTTTGATAGTTGAGGGACCAATTGTAATTGGTTTTTTGGTTGAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 45.30% 0.13% 0.00% NA
All Indica  2759 83.90% 16.10% 0.00% 0.00% NA
All Japonica  1512 8.30% 91.70% 0.07% 0.00% NA
Aus  269 10.80% 87.70% 1.49% 0.00% NA
Indica I  595 92.30% 7.70% 0.00% 0.00% NA
Indica II  465 93.50% 6.50% 0.00% 0.00% NA
Indica III  913 75.10% 24.90% 0.00% 0.00% NA
Indica Intermediate  786 82.20% 17.80% 0.00% 0.00% NA
Temperate Japonica  767 0.40% 99.60% 0.00% 0.00% NA
Tropical Japonica  504 22.60% 77.40% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.30% 0.41% 0.00% NA
VI/Aromatic  96 71.90% 28.10% 0.00% 0.00% NA
Intermediate  90 46.70% 52.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128839134 T -> C LOC_Os01g50180.1 upstream_gene_variant ; 270.0bp to feature; MODIFIER silent_mutation Average:77.189; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0128839134 T -> C LOC_Os01g50170.1 downstream_gene_variant ; 2249.0bp to feature; MODIFIER silent_mutation Average:77.189; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N
vg0128839134 T -> C LOC_Os01g50170-LOC_Os01g50180 intergenic_region ; MODIFIER silent_mutation Average:77.189; most accessible tissue: Minghui63 panicle, score: 91.034 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128839134 T C 0.01 0.01 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128839134 NA 4.27E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 5.71E-18 mr1253 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 1.60E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 1.86E-22 mr1807 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 1.00E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 1.44E-24 mr1401_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 7.36E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 1.90E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 1.06E-19 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128839134 NA 2.16E-08 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251