\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128531967:

Variant ID: vg0128531967 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28531967
Reference Allele: AAlternative Allele: T,C,G
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCCATGTGTTCTTAAAATGATTGCGTCCACAATCTAATAAGACAAAGCAAAATTTGTGCTACACAGACTCGAAAATTTAGCTCTAGGAGTTGGGTCTG[A/T,C,G]
AGCGGAGTTGTGGAGTAGCCAAAATCCAGCTCCACATCTCTAGTTCATTTTGTAAAAGTGTTCCACCTAGCTCTGCTCCCATTTTAAGTGAGCTCCAGCT

Reverse complement sequence

AGCTGGAGCTCACTTAAAATGGGAGCAGAGCTAGGTGGAACACTTTTACAAAATGAACTAGAGATGTGGAGCTGGATTTTGGCTACTCCACAACTCCGCT[T/A,G,C]
CAGACCCAACTCCTAGAGCTAAATTTTCGAGTCTGTGTAGCACAAATTTTGCTTTGTCTTATTAGATTGTGGACGCAATCATTTTAAGAACACATGGCCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 33.10% 19.00% 1.02% 46.91% C: 0.02%
All Indica  2759 5.10% 23.70% 0.18% 70.97% NA
All Japonica  1512 76.00% 6.30% 2.71% 15.01% NA
Aus  269 79.90% 19.70% 0.00% 0.00% C: 0.37%
Indica I  595 4.00% 42.50% 0.00% 53.45% NA
Indica II  465 2.40% 1.30% 0.22% 96.13% NA
Indica III  913 6.70% 22.90% 0.22% 70.21% NA
Indica Intermediate  786 5.70% 23.80% 0.25% 70.23% NA
Temperate Japonica  767 99.30% 0.30% 0.00% 0.39% NA
Tropical Japonica  504 33.90% 17.30% 7.34% 41.47% NA
Japonica Intermediate  241 89.60% 2.50% 1.66% 6.22% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 38.90% 26.70% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128531967 A -> G LOC_Os01g49630.1 upstream_gene_variant ; 2854.0bp to feature; MODIFIER N Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> G LOC_Os01g49614.2 downstream_gene_variant ; 4483.0bp to feature; MODIFIER N Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> G LOC_Os01g49614.3 downstream_gene_variant ; 32.0bp to feature; MODIFIER N Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> G LOC_Os01g49614.1 intron_variant ; MODIFIER N Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> T LOC_Os01g49630.1 upstream_gene_variant ; 2854.0bp to feature; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> T LOC_Os01g49614.2 downstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> T LOC_Os01g49614.3 downstream_gene_variant ; 32.0bp to feature; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> T LOC_Os01g49614.1 intron_variant ; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> DEL N N silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> C LOC_Os01g49630.1 upstream_gene_variant ; 2854.0bp to feature; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> C LOC_Os01g49614.2 downstream_gene_variant ; 4483.0bp to feature; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> C LOC_Os01g49614.3 downstream_gene_variant ; 32.0bp to feature; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N
vg0128531967 A -> C LOC_Os01g49614.1 intron_variant ; MODIFIER silent_mutation Average:46.733; most accessible tissue: Callus, score: 75.063 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128531967 NA 2.47E-47 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.47E-09 mr1089 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.82E-42 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.53E-48 mr1125 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.97E-34 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.98E-32 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 3.80E-10 mr1235 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.43E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.84E-27 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 3.30E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.93E-38 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.15E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 6.33E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 6.33E-16 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 8.68E-16 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.00E-06 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 7.94E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 9.62E-07 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.72E-18 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.68E-07 mr1716 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.63E-11 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.01E-14 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.17E-16 mr1732 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.07E-06 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 3.54E-09 mr1746 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 5.77E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.11E-06 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 5.59E-18 mr1807 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 8.37E-24 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 6.83E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 4.96E-10 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 6.78E-54 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 7.83E-62 mr1125_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.23E-36 mr1129_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.60E-10 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.15E-22 mr1253_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.07E-33 mr1257_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.46E-15 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 8.32E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 1.06E-10 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.43E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 6.38E-21 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 9.01E-09 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 6.97E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 4.57E-07 NA mr1991_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128531967 NA 2.44E-08 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251