\
| Variant ID: vg0128530844 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28530844 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 213. )
TATCTTTAGACCATTCTGAGCCATTTACGAACATTATGGCAAATATGATCAAGACATTTATAGCTCCCACATAAATAAGAAGTTGTGCCACAGCTACAAA[G/A]
TAGGAATTCAATAAAATATAGAATAAGGATATACAAACAAGAACTAATCCTAGCGAAAAAGCAGAAAAAGTTGGGTTGGTAAGTAATACCACCCCTAGAC
GTCTAGGGGTGGTATTACTTACCAACCCAACTTTTTCTGCTTTTTCGCTAGGATTAGTTCTTGTTTGTATATCCTTATTCTATATTTTATTGAATTCCTA[C/T]
TTTGTAGCTGTGGCACAACTTCTTATTTATGTGGGAGCTATAAATGTCTTGATCATATTTGCCATAATGTTCGTAAATGGCTCAGAATGGTCTAAAGATA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.10% | 20.10% | 0.36% | 47.40% | NA |
| All Indica | 2759 | 5.30% | 23.80% | 0.43% | 70.46% | NA |
| All Japonica | 1512 | 72.80% | 9.60% | 0.13% | 17.53% | NA |
| Aus | 269 | 79.90% | 20.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 3.90% | 42.50% | 0.50% | 53.11% | NA |
| Indica II | 465 | 2.20% | 1.50% | 0.43% | 95.91% | NA |
| Indica III | 913 | 7.20% | 22.90% | 0.33% | 69.55% | NA |
| Indica Intermediate | 786 | 6.00% | 23.90% | 0.51% | 69.59% | NA |
| Temperate Japonica | 767 | 93.00% | 6.60% | 0.00% | 0.39% | NA |
| Tropical Japonica | 504 | 33.90% | 17.50% | 0.20% | 48.41% | NA |
| Japonica Intermediate | 241 | 89.60% | 2.50% | 0.41% | 7.47% | NA |
| VI/Aromatic | 96 | 25.00% | 71.90% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 36.70% | 28.90% | 3.33% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128530844 | G -> A | LOC_Os01g49630.1 | upstream_gene_variant ; 3977.0bp to feature; MODIFIER | silent_mutation | Average:7.421; most accessible tissue: Callus, score: 31.168 | N | N | N | N |
| vg0128530844 | G -> A | LOC_Os01g49614.2 | downstream_gene_variant ; 3360.0bp to feature; MODIFIER | silent_mutation | Average:7.421; most accessible tissue: Callus, score: 31.168 | N | N | N | N |
| vg0128530844 | G -> A | LOC_Os01g49614.1 | intron_variant ; MODIFIER | silent_mutation | Average:7.421; most accessible tissue: Callus, score: 31.168 | N | N | N | N |
| vg0128530844 | G -> A | LOC_Os01g49614.3 | intron_variant ; MODIFIER | silent_mutation | Average:7.421; most accessible tissue: Callus, score: 31.168 | N | N | N | N |
| vg0128530844 | G -> DEL | N | N | silent_mutation | Average:7.421; most accessible tissue: Callus, score: 31.168 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128530844 | NA | 3.73E-23 | Plant_height | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0128530844 | NA | 5.99E-20 | Plant_height | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0128530844 | NA | 2.21E-09 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 9.19E-08 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.70E-10 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.60E-09 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.89E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 6.03E-10 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 9.04E-06 | mr1706 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 5.37E-06 | mr1889 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 3.00E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.95E-09 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 7.67E-07 | mr1024_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 3.99E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.76E-06 | mr1092_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 6.02E-08 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.41E-06 | mr1128_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.79E-07 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.57E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 7.71E-09 | mr1183_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | 7.65E-06 | 5.96E-10 | mr1204_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.14E-08 | mr1204_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.11E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.07E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.10E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 3.46E-07 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.11E-06 | mr1296_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.14E-06 | mr1306_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.66E-06 | mr1320_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.23E-09 | mr1352_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.09E-08 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 8.11E-06 | mr1381_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 3.80E-06 | mr1421_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.29E-08 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.72E-06 | mr1505_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 5.05E-07 | mr1517_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 6.74E-06 | mr1545_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.76E-07 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 8.31E-08 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.18E-06 | mr1611_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.87E-06 | mr1617_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.94E-07 | mr1624_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.25E-06 | mr1641_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.47E-08 | mr1661_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 8.20E-07 | mr1661_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.57E-07 | mr1671_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 7.19E-07 | mr1696_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 7.77E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.06E-10 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.46E-11 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.66E-07 | mr1743_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 3.61E-08 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.78E-11 | mr1758_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 8.38E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.51E-07 | mr1767_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 9.80E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.53E-06 | mr1820_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.93E-06 | mr1820_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.12E-07 | mr1838_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 8.31E-08 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 1.27E-07 | mr1909_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 4.64E-06 | mr1921_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.18E-06 | mr1954_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 2.09E-06 | mr1959_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 6.86E-06 | mr1968_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128530844 | NA | 3.24E-06 | mr1970_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |