\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128530606:

Variant ID: vg0128530606 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28530606
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.61, C: 0.39, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


AATTTATTTTTCATGATAAGAGTGTTATGCAAATCAAATACGGTACATAAATGGTGTCATGCTAAATGAATCTCAATTTGTTGAACATTATTTATGAGAC[C/T]
CTGTTCTACTATTTGGTTTGATCTTGTAGTCCAAATAATTCCATACCATGACGTATCTGGGATAGTAGTCATTAGTGAAAAAGGAATAGTTATACAAACG

Reverse complement sequence

CGTTTGTATAACTATTCCTTTTTCACTAATGACTACTATCCCAGATACGTCATGGTATGGAATTATTTGGACTACAAGATCAAACCAAATAGTAGAACAG[G/A]
GTCTCATAAATAATGTTCAACAAATTGAGATTCATTTAGCATGACACCATTTATGTACCGTATTTGATTTGCATAACACTCTTATCATGAAAAATAAATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.30% 20.10% 0.25% 47.29% NA
All Indica  2759 5.60% 23.90% 0.29% 70.21% NA
All Japonica  1512 72.80% 9.50% 0.13% 17.59% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 4.40% 42.50% 0.00% 53.11% NA
Indica II  465 3.20% 1.70% 0.43% 94.62% NA
Indica III  913 7.30% 22.90% 0.22% 69.55% NA
Indica Intermediate  786 6.00% 24.00% 0.51% 69.47% NA
Temperate Japonica  767 93.00% 6.60% 0.00% 0.39% NA
Tropical Japonica  504 33.90% 17.30% 0.40% 48.41% NA
Japonica Intermediate  241 89.60% 2.50% 0.00% 7.88% NA
VI/Aromatic  96 25.00% 71.90% 0.00% 3.12% NA
Intermediate  90 37.80% 27.80% 2.22% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128530606 C -> T LOC_Os01g49630.1 upstream_gene_variant ; 4215.0bp to feature; MODIFIER silent_mutation Average:18.114; most accessible tissue: Callus, score: 46.399 N N N N
vg0128530606 C -> T LOC_Os01g49614.2 downstream_gene_variant ; 3122.0bp to feature; MODIFIER silent_mutation Average:18.114; most accessible tissue: Callus, score: 46.399 N N N N
vg0128530606 C -> T LOC_Os01g49614.1 intron_variant ; MODIFIER silent_mutation Average:18.114; most accessible tissue: Callus, score: 46.399 N N N N
vg0128530606 C -> T LOC_Os01g49614.3 intron_variant ; MODIFIER silent_mutation Average:18.114; most accessible tissue: Callus, score: 46.399 N N N N
vg0128530606 C -> DEL N N silent_mutation Average:18.114; most accessible tissue: Callus, score: 46.399 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128530606 NA 5.72E-08 mr1156 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 5.03E-06 mr1179 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 8.96E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 6.68E-08 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 4.47E-06 mr1889 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 2.72E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 1.88E-07 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 2.01E-07 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 3.42E-08 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 7.29E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 7.92E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 7.16E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 3.99E-07 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 6.45E-06 mr1421_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 1.71E-07 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 8.10E-07 2.50E-10 mr1555_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 8.75E-06 mr1555_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 5.70E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 1.17E-06 1.17E-06 mr1574_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 8.12E-06 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 4.23E-06 mr1661_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 6.06E-07 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 1.49E-07 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 1.52E-08 mr1743_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 1.60E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 2.28E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 6.75E-07 mr1767_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 5.73E-07 mr1806_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 6.72E-10 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128530606 NA 1.23E-08 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251