\
| Variant ID: vg0128529665 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28529665 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 49. )
TGCTGCCGCTCCTCCTTGTCTTGGTTGCCGCTTCCCATGGCGCTTCCAATGACACCTACGACACCTCCATGTGCCTGCAGGAAACAACCACCTGCGGGGA[T/C]
GTCAGTATCAGATACCCGTTCTACTTTTCTGATAAGACGGGATATATCAACGGGTCCAGCAACTCATACTGCGGATACCCCGGCCTGGCGATCGATTGTG
CACAATCGATCGCCAGGCCGGGGTATCCGCAGTATGAGTTGCTGGACCCGTTGATATATCCCGTCTTATCAGAAAAGTAGAACGGGTATCTGATACTGAC[A/G]
TCCCCGCAGGTGGTTGTTTCCTGCAGGCACATGGAGGTGTCGTAGGTGTCATTGGAAGCGCCATGGGAAGCGGCAACCAAGACAAGGAGGAGCGGCAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.10% | 24.00% | 0.59% | 1.25% | NA |
| All Indica | 2759 | 97.50% | 1.00% | 0.07% | 1.38% | NA |
| All Japonica | 1512 | 26.50% | 70.50% | 1.72% | 1.32% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.50% | 1.20% | 0.00% | 0.34% | NA |
| Indica II | 465 | 97.80% | 1.70% | 0.43% | 0.00% | NA |
| Indica III | 913 | 95.90% | 0.20% | 0.00% | 3.83% | NA |
| Indica Intermediate | 786 | 98.50% | 1.40% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 7.20% | 89.60% | 0.91% | 2.35% | NA |
| Tropical Japonica | 504 | 63.10% | 33.10% | 3.77% | 0.00% | NA |
| Japonica Intermediate | 241 | 11.20% | 88.00% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 68.90% | 30.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128529665 | T -> DEL | N | N | silent_mutation | Average:14.211; most accessible tissue: Callus, score: 32.289 | N | N | N | N |
| vg0128529665 | T -> C | LOC_Os01g49614.2 | downstream_gene_variant ; 2181.0bp to feature; MODIFIER | silent_mutation | Average:14.211; most accessible tissue: Callus, score: 32.289 | N | N | N | N |
| vg0128529665 | T -> C | LOC_Os01g49614.1 | intron_variant ; MODIFIER | silent_mutation | Average:14.211; most accessible tissue: Callus, score: 32.289 | N | N | N | N |
| vg0128529665 | T -> C | LOC_Os01g49614.3 | intron_variant ; MODIFIER | silent_mutation | Average:14.211; most accessible tissue: Callus, score: 32.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128529665 | NA | 1.64E-07 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 1.56E-07 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 5.89E-06 | mr1060_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 1.64E-06 | mr1115_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 2.61E-06 | mr1204_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 4.56E-08 | mr1296_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 1.28E-06 | mr1358_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 3.26E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 7.09E-07 | mr1528_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 3.17E-08 | mr1555_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 5.48E-07 | mr1571_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | 3.13E-06 | 3.13E-06 | mr1574_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 2.34E-06 | mr1661_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 6.30E-10 | mr1743_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 1.31E-07 | mr1743_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 3.47E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 4.58E-06 | mr1756_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 6.37E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128529665 | NA | 3.67E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |