\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128528170:

Variant ID: vg0128528170 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28528170
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CATCTCGTCCATCATGCCCAACTAGATCCAACAATTAGAAACGATTTAGTACCGTGAGGTACCGGTACCTCAAGGTACTTTTTGTTGGATCGGAGCAAAT[T/C]
TCTTTGAAATTTCATCCAAACGTCCAAGTGCATGACACCTCCGCATTTGCTTATACTTGGTAGACCCCTAAAATCTATATATCTTTGCCATTCAGATGTA

Reverse complement sequence

TACATCTGAATGGCAAAGATATATAGATTTTAGGGGTCTACCAAGTATAAGCAAATGCGGAGGTGTCATGCACTTGGACGTTTGGATGAAATTTCAAAGA[A/G]
ATTTGCTCCGATCCAACAAAAAGTACCTTGAGGTACCGGTACCTCACGGTACTAAATCGTTTCTAATTGTTGGATCTAGTTGGGCATGATGGACGAGATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.00% 11.10% 2.94% 48.92% NA
All Indica  2759 26.30% 0.30% 0.76% 72.67% NA
All Japonica  1512 41.30% 33.30% 7.54% 17.92% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 44.90% 0.00% 1.01% 54.12% NA
Indica II  465 1.90% 0.40% 1.08% 96.56% NA
Indica III  913 25.20% 0.10% 0.22% 74.48% NA
Indica Intermediate  786 28.00% 0.50% 1.02% 70.48% NA
Temperate Japonica  767 29.70% 58.30% 11.60% 0.39% NA
Tropical Japonica  504 47.00% 1.80% 1.98% 49.21% NA
Japonica Intermediate  241 66.00% 19.50% 6.22% 8.30% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 43.30% 15.60% 4.44% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128528170 T -> DEL N N silent_mutation Average:17.567; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528170 T -> C LOC_Os01g49600.1 downstream_gene_variant ; 4422.0bp to feature; MODIFIER silent_mutation Average:17.567; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528170 T -> C LOC_Os01g49614.2 downstream_gene_variant ; 686.0bp to feature; MODIFIER silent_mutation Average:17.567; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528170 T -> C LOC_Os01g49614.1 intron_variant ; MODIFIER silent_mutation Average:17.567; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528170 T -> C LOC_Os01g49614.3 intron_variant ; MODIFIER silent_mutation Average:17.567; most accessible tissue: Callus, score: 32.337 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128528170 NA 3.64E-11 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128528170 8.00E-09 1.95E-35 mr1137 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 3.35E-15 mr1137 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 5.11E-06 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 5.39E-06 9.32E-27 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 2.16E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 1.68E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 4.90E-08 9.29E-38 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 7.78E-15 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 1.19E-06 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 8.54E-07 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 2.72E-06 mr1555_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 9.87E-06 mr1596_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170 NA 6.05E-08 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251