Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128528170:

Variant ID: vg0128528170 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28528170
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CATCTCGTCCATCATGCCCAACTAGATCCAACAATTAGAAACGATTTAGTACCGTGAGGTACCGGTACCTCAAGGTACTTTTTGTTGGATCGGAGCAAAT[T/C]
TCTTTGAAATTTCATCCAAACGTCCAAGTGCATGACACCTCCGCATTTGCTTATACTTGGTAGACCCCTAAAATCTATATATCTTTGCCATTCAGATGTA

Reverse complement sequence

TACATCTGAATGGCAAAGATATATAGATTTTAGGGGTCTACCAAGTATAAGCAAATGCGGAGGTGTCATGCACTTGGACGTTTGGATGAAATTTCAAAGA[A/G]
ATTTGCTCCGATCCAACAAAAAGTACCTTGAGGTACCGGTACCTCACGGTACTAAATCGTTTCTAATTGTTGGATCTAGTTGGGCATGATGGACGAGATG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	37.00%	11.10%	2.94%	48.92%	NA
All Indica	2759	26.30%	0.30%	0.76%	72.67%	NA
All Japonica	1512	41.30%	33.30%	7.54%	17.92%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	44.90%	0.00%	1.01%	54.12%	NA
Indica II	465	1.90%	0.40%	1.08%	96.56%	NA
Indica III	913	25.20%	0.10%	0.22%	74.48%	NA
Indica Intermediate	786	28.00%	0.50%	1.02%	70.48%	NA
Temperate Japonica	767	29.70%	58.30%	11.60%	0.39%	NA
Tropical Japonica	504	47.00%	1.80%	1.98%	49.21%	NA
Japonica Intermediate	241	66.00%	19.50%	6.22%	8.30%	NA
VI/Aromatic	96	96.90%	0.00%	0.00%	3.12%	NA
Intermediate	90	43.30%	15.60%	4.44%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128528170	T -> DEL	N	N	silent_mutation	Average:17.567; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528170	T -> C	LOC_Os01g49600.1	downstream_gene_variant ; 4422.0bp to feature; MODIFIER	silent_mutation	Average:17.567; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528170	T -> C	LOC_Os01g49614.2	downstream_gene_variant ; 686.0bp to feature; MODIFIER	silent_mutation	Average:17.567; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528170	T -> C	LOC_Os01g49614.1	intron_variant ; MODIFIER	silent_mutation	Average:17.567; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528170	T -> C	LOC_Os01g49614.3	intron_variant ; MODIFIER	silent_mutation	Average:17.567; most accessible tissue: Callus, score: 32.337	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128528170	NA	3.64E-11	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128528170	8.00E-09	1.95E-35	mr1137	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	3.35E-15	mr1137	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	5.11E-06	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	5.39E-06	9.32E-27	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	2.16E-10	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	1.68E-06	mr1077_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	4.90E-08	9.29E-38	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	7.78E-15	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	1.19E-06	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	8.54E-07	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	2.72E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	9.87E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528170	NA	6.05E-08	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251