\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128528102:

Variant ID: vg0128528102 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28528102
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.44, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAAAAAAGGAAACCACGTAGAGAAGAGGGAGAGGGGGGCGCCACGGGCGATCGATCACCTGTTAGCCATCTCGTCCATCATGCCCAACTAGATCCAAC[A/G]
ATTAGAAACGATTTAGTACCGTGAGGTACCGGTACCTCAAGGTACTTTTTGTTGGATCGGAGCAAATTTCTTTGAAATTTCATCCAAACGTCCAAGTGCA

Reverse complement sequence

TGCACTTGGACGTTTGGATGAAATTTCAAAGAAATTTGCTCCGATCCAACAAAAAGTACCTTGAGGTACCGGTACCTCACGGTACTAAATCGTTTCTAAT[T/C]
GTTGGATCTAGTTGGGCATGATGGACGAGATGGCTAACAGGTGATCGATCGCCCGTGGCGCCCCCCTCTCCCTCTTCTCTACGTGGTTTCCTTTTTTGGC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.00% 19.00% 0.42% 48.62% NA
All Indica  2759 5.10% 22.10% 0.51% 72.27% NA
All Japonica  1512 72.50% 9.50% 0.33% 17.72% NA
Aus  269 79.60% 20.10% 0.37% 0.00% NA
Indica I  595 3.90% 41.50% 0.67% 53.95% NA
Indica II  465 3.00% 1.10% 0.86% 95.05% NA
Indica III  913 6.60% 18.90% 0.22% 74.26% NA
Indica Intermediate  786 5.70% 23.40% 0.51% 70.36% NA
Temperate Japonica  767 93.00% 6.50% 0.13% 0.39% NA
Tropical Japonica  504 33.50% 17.30% 0.60% 48.61% NA
Japonica Intermediate  241 88.80% 2.50% 0.41% 8.30% NA
VI/Aromatic  96 26.00% 70.80% 0.00% 3.12% NA
Intermediate  90 36.70% 26.70% 0.00% 36.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128528102 A -> G LOC_Os01g49600.1 downstream_gene_variant ; 4354.0bp to feature; MODIFIER silent_mutation Average:21.129; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528102 A -> G LOC_Os01g49614.2 downstream_gene_variant ; 618.0bp to feature; MODIFIER silent_mutation Average:21.129; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528102 A -> G LOC_Os01g49614.1 intron_variant ; MODIFIER silent_mutation Average:21.129; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528102 A -> G LOC_Os01g49614.3 intron_variant ; MODIFIER silent_mutation Average:21.129; most accessible tissue: Callus, score: 32.337 N N N N
vg0128528102 A -> DEL N N silent_mutation Average:21.129; most accessible tissue: Callus, score: 32.337 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128528102 NA 2.17E-09 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 1.63E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 3.48E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 4.12E-07 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 3.81E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 3.44E-08 mr1896 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 5.29E-06 mr1903 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 5.41E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 3.12E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102 NA 6.87E-16 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251