Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0128528102:

Variant ID: vg0128528102 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28528102
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.56, G: 0.44, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAAAAAAGGAAACCACGTAGAGAAGAGGGAGAGGGGGGCGCCACGGGCGATCGATCACCTGTTAGCCATCTCGTCCATCATGCCCAACTAGATCCAAC[A/G]
ATTAGAAACGATTTAGTACCGTGAGGTACCGGTACCTCAAGGTACTTTTTGTTGGATCGGAGCAAATTTCTTTGAAATTTCATCCAAACGTCCAAGTGCA

Reverse complement sequence

TGCACTTGGACGTTTGGATGAAATTTCAAAGAAATTTGCTCCGATCCAACAAAAAGTACCTTGAGGTACCGGTACCTCACGGTACTAAATCGTTTCTAAT[T/C]
GTTGGATCTAGTTGGGCATGATGGACGAGATGGCTAACAGGTGATCGATCGCCCGTGGCGCCCCCCTCTCCCTCTTCTCTACGTGGTTTCCTTTTTTGGC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.00%	19.00%	0.42%	48.62%	NA
All Indica	2759	5.10%	22.10%	0.51%	72.27%	NA
All Japonica	1512	72.50%	9.50%	0.33%	17.72%	NA
Aus	269	79.60%	20.10%	0.37%	0.00%	NA
Indica I	595	3.90%	41.50%	0.67%	53.95%	NA
Indica II	465	3.00%	1.10%	0.86%	95.05%	NA
Indica III	913	6.60%	18.90%	0.22%	74.26%	NA
Indica Intermediate	786	5.70%	23.40%	0.51%	70.36%	NA
Temperate Japonica	767	93.00%	6.50%	0.13%	0.39%	NA
Tropical Japonica	504	33.50%	17.30%	0.60%	48.61%	NA
Japonica Intermediate	241	88.80%	2.50%	0.41%	8.30%	NA
VI/Aromatic	96	26.00%	70.80%	0.00%	3.12%	NA
Intermediate	90	36.70%	26.70%	0.00%	36.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128528102	A -> G	LOC_Os01g49600.1	downstream_gene_variant ; 4354.0bp to feature; MODIFIER	silent_mutation	Average:21.129; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528102	A -> G	LOC_Os01g49614.2	downstream_gene_variant ; 618.0bp to feature; MODIFIER	silent_mutation	Average:21.129; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528102	A -> G	LOC_Os01g49614.1	intron_variant ; MODIFIER	silent_mutation	Average:21.129; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528102	A -> G	LOC_Os01g49614.3	intron_variant ; MODIFIER	silent_mutation	Average:21.129; most accessible tissue: Callus, score: 32.337	N	N	N	N
vg0128528102	A -> DEL	N	N	silent_mutation	Average:21.129; most accessible tissue: Callus, score: 32.337	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128528102	NA	2.17E-09	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	1.63E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	3.48E-07	mr1555	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	4.12E-07	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	3.81E-10	mr1720	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	3.44E-08	mr1896	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	5.29E-06	mr1903	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	5.41E-07	mr1679_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	3.12E-15	mr1720_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128528102	NA	6.87E-16	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251