\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128519132:

Variant ID: vg0128519132 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28519132
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTCTCGAACTTTTTTCTCCTCCCTACTAGTAAAACTTGTTTTATGTTTTTTAGGGTTTTTGTTTTAACGCCTGATTTTCATCACGCTACCAAATAAGA[A/G]
TAAGTTTCTCAGCCGACTACTTGTTTTAAATTATTTTTTATCAATCCAATAGCCTATTTGTACAATAGTAGTCAATCGGCCCATTAGAGCAGTATGTCTG

Reverse complement sequence

CAGACATACTGCTCTAATGGGCCGATTGACTACTATTGTACAAATAGGCTATTGGATTGATAAAAAATAATTTAAAACAAGTAGTCGGCTGAGAAACTTA[T/C]
TCTTATTTGGTAGCGTGATGAAAATCAGGCGTTAAAACAAAAACCCTAAAAAACATAAAACAAGTTTTACTAGTAGGGAGGAGAAAAAAGTTCGAGAAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.80% 27.00% 1.80% 3.39% NA
All Indica  2759 92.70% 3.40% 0.36% 3.59% NA
All Japonica  1512 16.10% 75.30% 4.70% 3.84% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 93.40% 3.40% 0.17% 3.03% NA
Indica II  465 89.50% 1.70% 1.51% 7.31% NA
Indica III  913 92.90% 5.10% 0.00% 1.97% NA
Indica Intermediate  786 93.80% 2.30% 0.25% 3.69% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 42.90% 32.70% 13.29% 11.11% NA
Japonica Intermediate  241 9.50% 88.00% 1.66% 0.83% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 61.10% 31.10% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128519132 A -> G LOC_Os01g49600.1 upstream_gene_variant ; 3028.0bp to feature; MODIFIER silent_mutation Average:40.572; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519132 A -> G LOC_Os01g49614.1 upstream_gene_variant ; 4874.0bp to feature; MODIFIER silent_mutation Average:40.572; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519132 A -> G LOC_Os01g49614.2 upstream_gene_variant ; 4874.0bp to feature; MODIFIER silent_mutation Average:40.572; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519132 A -> G LOC_Os01g49614.3 upstream_gene_variant ; 4874.0bp to feature; MODIFIER silent_mutation Average:40.572; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519132 A -> G LOC_Os01g49580.1 downstream_gene_variant ; 1563.0bp to feature; MODIFIER silent_mutation Average:40.572; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519132 A -> G LOC_Os01g49580-LOC_Os01g49600 intergenic_region ; MODIFIER silent_mutation Average:40.572; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519132 A -> DEL N N silent_mutation Average:40.572; most accessible tissue: Callus, score: 67.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128519132 NA 1.18E-35 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128519132 NA 2.13E-58 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128519132 NA 8.11E-42 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 9.88E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 7.54E-39 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 4.19E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 1.45E-101 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 8.98E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 3.66E-31 mr1448 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 2.45E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 1.82E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 7.91E-36 mr1486 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 2.38E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 1.05E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 4.40E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 9.12E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 3.06E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 5.07E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 5.78E-44 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 4.92E-36 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 8.82E-27 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 1.61E-06 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 2.64E-23 mr1862 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 9.36E-32 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 6.79E-51 mr1089_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 6.91E-50 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 7.00E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 7.65E-52 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 9.97E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 7.20E-08 3.39E-120 mr1334_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 6.96E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 7.97E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 1.35E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 2.47E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 5.66E-23 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 4.53E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 2.51E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 1.98E-44 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 8.46E-09 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 5.72E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 6.96E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 2.30E-07 9.18E-63 mr1991_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519132 NA 8.63E-09 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251