\
| Variant ID: vg0128519132 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28519132 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ACTTCTCGAACTTTTTTCTCCTCCCTACTAGTAAAACTTGTTTTATGTTTTTTAGGGTTTTTGTTTTAACGCCTGATTTTCATCACGCTACCAAATAAGA[A/G]
TAAGTTTCTCAGCCGACTACTTGTTTTAAATTATTTTTTATCAATCCAATAGCCTATTTGTACAATAGTAGTCAATCGGCCCATTAGAGCAGTATGTCTG
CAGACATACTGCTCTAATGGGCCGATTGACTACTATTGTACAAATAGGCTATTGGATTGATAAAAAATAATTTAAAACAAGTAGTCGGCTGAGAAACTTA[T/C]
TCTTATTTGGTAGCGTGATGAAAATCAGGCGTTAAAACAAAAACCCTAAAAAACATAAAACAAGTTTTACTAGTAGGGAGGAGAAAAAAGTTCGAGAAGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.80% | 27.00% | 1.80% | 3.39% | NA |
| All Indica | 2759 | 92.70% | 3.40% | 0.36% | 3.59% | NA |
| All Japonica | 1512 | 16.10% | 75.30% | 4.70% | 3.84% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.40% | 3.40% | 0.17% | 3.03% | NA |
| Indica II | 465 | 89.50% | 1.70% | 1.51% | 7.31% | NA |
| Indica III | 913 | 92.90% | 5.10% | 0.00% | 1.97% | NA |
| Indica Intermediate | 786 | 93.80% | 2.30% | 0.25% | 3.69% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 42.90% | 32.70% | 13.29% | 11.11% | NA |
| Japonica Intermediate | 241 | 9.50% | 88.00% | 1.66% | 0.83% | NA |
| VI/Aromatic | 96 | 86.50% | 13.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 31.10% | 4.44% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128519132 | A -> G | LOC_Os01g49600.1 | upstream_gene_variant ; 3028.0bp to feature; MODIFIER | silent_mutation | Average:40.572; most accessible tissue: Callus, score: 67.431 | N | N | N | N |
| vg0128519132 | A -> G | LOC_Os01g49614.1 | upstream_gene_variant ; 4874.0bp to feature; MODIFIER | silent_mutation | Average:40.572; most accessible tissue: Callus, score: 67.431 | N | N | N | N |
| vg0128519132 | A -> G | LOC_Os01g49614.2 | upstream_gene_variant ; 4874.0bp to feature; MODIFIER | silent_mutation | Average:40.572; most accessible tissue: Callus, score: 67.431 | N | N | N | N |
| vg0128519132 | A -> G | LOC_Os01g49614.3 | upstream_gene_variant ; 4874.0bp to feature; MODIFIER | silent_mutation | Average:40.572; most accessible tissue: Callus, score: 67.431 | N | N | N | N |
| vg0128519132 | A -> G | LOC_Os01g49580.1 | downstream_gene_variant ; 1563.0bp to feature; MODIFIER | silent_mutation | Average:40.572; most accessible tissue: Callus, score: 67.431 | N | N | N | N |
| vg0128519132 | A -> G | LOC_Os01g49580-LOC_Os01g49600 | intergenic_region ; MODIFIER | silent_mutation | Average:40.572; most accessible tissue: Callus, score: 67.431 | N | N | N | N |
| vg0128519132 | A -> DEL | N | N | silent_mutation | Average:40.572; most accessible tissue: Callus, score: 67.431 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128519132 | NA | 1.18E-35 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0128519132 | NA | 2.13E-58 | Grain_width | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0128519132 | NA | 8.11E-42 | mr1089 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 9.88E-41 | mr1093 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 7.54E-39 | mr1235 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 4.19E-07 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 1.45E-101 | mr1334 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 8.98E-14 | mr1334 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 3.66E-31 | mr1448 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 2.45E-11 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 1.82E-06 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 7.91E-36 | mr1486 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 2.38E-14 | mr1540 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 1.05E-06 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 4.40E-21 | mr1679 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 9.12E-17 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 3.06E-06 | mr1704 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 5.07E-17 | mr1768 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 5.78E-44 | mr1771 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 4.92E-36 | mr1784 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 8.82E-27 | mr1805 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 1.61E-06 | mr1815 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 2.64E-23 | mr1862 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 9.36E-32 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 6.79E-51 | mr1089_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 6.91E-50 | mr1093_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 7.00E-13 | mr1217_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 7.65E-52 | mr1235_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 9.97E-13 | mr1248_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | 7.20E-08 | 3.39E-120 | mr1334_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 6.96E-17 | mr1334_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 7.97E-11 | mr1471_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 1.35E-09 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 2.47E-26 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 5.66E-23 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 4.53E-18 | mr1682_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 2.51E-43 | mr1784_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 1.98E-44 | mr1805_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 8.46E-09 | mr1807_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 5.72E-08 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 6.96E-08 | mr1817_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | 2.30E-07 | 9.18E-63 | mr1991_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128519132 | NA | 8.63E-09 | mr1991_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |