\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128519107:

Variant ID: vg0128519107 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28519107
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, G: 0.01, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


TTCGAAAACACATCCGAAAACGGAAACTTCTCGAACTTTTTTCTCCTCCCTACTAGTAAAACTTGTTTTATGTTTTTTAGGGTTTTTGTTTTAACGCCTG[A/G]
TTTTCATCACGCTACCAAATAAGAATAAGTTTCTCAGCCGACTACTTGTTTTAAATTATTTTTTATCAATCCAATAGCCTATTTGTACAATAGTAGTCAA

Reverse complement sequence

TTGACTACTATTGTACAAATAGGCTATTGGATTGATAAAAAATAATTTAAAACAAGTAGTCGGCTGAGAAACTTATTCTTATTTGGTAGCGTGATGAAAA[T/C]
CAGGCGTTAAAACAAAAACCCTAAAAAACATAAAACAAGTTTTACTAGTAGGGAGGAGAAAAAAGTTCGAGAAGTTTCCGTTTTCGGATGTGTTTTCGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.90% 27.10% 1.71% 3.30% NA
All Indica  2759 92.60% 3.30% 0.51% 3.52% NA
All Japonica  1512 16.50% 75.70% 4.10% 3.70% NA
Aus  269 98.50% 1.50% 0.00% 0.00% NA
Indica I  595 93.30% 3.20% 0.50% 3.03% NA
Indica II  465 89.50% 1.70% 1.51% 7.31% NA
Indica III  913 92.90% 5.10% 0.22% 1.75% NA
Indica Intermediate  786 93.80% 2.30% 0.25% 3.69% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 43.80% 33.50% 11.90% 10.71% NA
Japonica Intermediate  241 9.50% 88.80% 0.83% 0.83% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 62.20% 28.90% 5.56% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128519107 A -> G LOC_Os01g49600.1 upstream_gene_variant ; 3053.0bp to feature; MODIFIER silent_mutation Average:34.725; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519107 A -> G LOC_Os01g49614.1 upstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:34.725; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519107 A -> G LOC_Os01g49614.2 upstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:34.725; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519107 A -> G LOC_Os01g49614.3 upstream_gene_variant ; 4899.0bp to feature; MODIFIER silent_mutation Average:34.725; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519107 A -> G LOC_Os01g49580.1 downstream_gene_variant ; 1538.0bp to feature; MODIFIER silent_mutation Average:34.725; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519107 A -> G LOC_Os01g49580-LOC_Os01g49600 intergenic_region ; MODIFIER silent_mutation Average:34.725; most accessible tissue: Callus, score: 67.431 N N N N
vg0128519107 A -> DEL N N silent_mutation Average:34.725; most accessible tissue: Callus, score: 67.431 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128519107 NA 4.45E-35 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128519107 NA 6.20E-58 Grain_width All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128519107 NA 1.44E-41 mr1089 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 5.26E-41 mr1093 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.10E-38 mr1235 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 4.19E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 5.28E-100 mr1334 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 8.98E-14 mr1334 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.05E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.82E-06 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 2.38E-14 mr1540 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.05E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 5.43E-21 mr1679 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 9.12E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 3.16E-06 mr1704 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 6.71E-17 mr1768 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.32E-43 mr1771 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 3.04E-36 mr1784 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 9.79E-27 mr1805 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 6.36E-31 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.47E-49 mr1093_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 7.96E-13 mr1217_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.09E-51 mr1235_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 9.40E-13 mr1248_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 2.52E-07 9.61E-118 mr1334_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 6.96E-17 mr1334_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 7.97E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 1.35E-09 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 4.53E-26 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 2.45E-22 mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 8.88E-43 mr1784_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 9.80E-44 mr1805_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 8.46E-09 mr1807_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 5.72E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 6.96E-08 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 1.77E-07 1.10E-62 mr1991_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128519107 NA 8.63E-09 mr1991_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251