\
| Variant ID: vg0128511406 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28511406 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, C: 0.03, others allele: 0.00, population size: 99. )
GACTGGTATATAAACTTGACAATAACGTGCATTTTAGTCAAAAACATTGATGCATACATTTGATTAATCCTGGTATTGCTAGATCATTGACTGATGGATT[T/C]
AATTTCGTGTTCTGCCATGTTCATAACTCGAGATAATGAATATGTTGATTAATCGAATCGCTCGGAAATTATGTTATTTGCATGTACTTACTTTTGATAA
TTATCAAAAGTAAGTACATGCAAATAACATAATTTCCGAGCGATTCGATTAATCAACATATTCATTATCTCGAGTTATGAACATGGCAGAACACGAAATT[A/G]
AATCCATCAGTCAATGATCTAGCAATACCAGGATTAATCAAATGTATGCATCAATGTTTTTGACTAAAATGCACGTTATTGTCAAGTTTATATACCAGTC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 48.90% | 27.20% | 0.63% | 23.30% | NA |
| All Indica | 2759 | 72.30% | 3.50% | 0.62% | 23.56% | NA |
| All Japonica | 1512 | 18.30% | 75.10% | 0.33% | 6.28% | NA |
| Aus | 269 | 0.00% | 3.70% | 2.23% | 94.05% | NA |
| Indica I | 595 | 54.30% | 3.90% | 1.18% | 40.67% | NA |
| Indica II | 465 | 97.20% | 1.70% | 0.00% | 1.08% | NA |
| Indica III | 913 | 71.60% | 5.30% | 0.22% | 22.89% | NA |
| Indica Intermediate | 786 | 72.00% | 2.30% | 1.02% | 24.68% | NA |
| Temperate Japonica | 767 | 0.50% | 99.20% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 50.00% | 32.30% | 0.60% | 17.06% | NA |
| Japonica Intermediate | 241 | 8.30% | 88.00% | 0.83% | 2.90% | NA |
| VI/Aromatic | 96 | 4.20% | 13.50% | 1.04% | 81.25% | NA |
| Intermediate | 90 | 38.90% | 32.20% | 1.11% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128511406 | T -> DEL | N | N | silent_mutation | Average:27.499; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0128511406 | T -> C | LOC_Os01g49570.1 | upstream_gene_variant ; 1833.0bp to feature; MODIFIER | silent_mutation | Average:27.499; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0128511406 | T -> C | LOC_Os01g49580.1 | upstream_gene_variant ; 1691.0bp to feature; MODIFIER | silent_mutation | Average:27.499; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0128511406 | T -> C | LOC_Os01g49570-LOC_Os01g49580 | intergenic_region ; MODIFIER | silent_mutation | Average:27.499; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128511406 | NA | 2.74E-06 | mr1047 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 2.58E-09 | mr1457 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 6.81E-08 | mr1471 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 1.36E-07 | mr1543 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 2.33E-07 | mr1642 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 3.22E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 8.91E-09 | mr1742 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | 9.53E-06 | 9.52E-06 | mr1815 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 4.33E-20 | mr1352_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 1.76E-08 | mr1364_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 7.18E-08 | mr1376_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 3.51E-08 | mr1431_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 1.02E-10 | mr1471_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 2.17E-10 | mr1642_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 1.93E-07 | mr1807_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128511406 | NA | 1.35E-07 | mr1808_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |