Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128510736:

Variant ID: vg0128510736 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28510736
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

TAATTGTTTTTTTTTTCACATTTAATACTCCATACATGTGTCTAAACATTCGATGTGATGGGTGAAAAGTTTCTGTTTTGATAACTAAACAAGGCCTAAA[G/A]
GAAGATCCTCAGAAATGAGTTACGGGGTTGGGCTTTTGTGAAATGGATTTAGTGTCGCTTTGTCAGGTTGTAACGGCGTGACGCAGTGATTAGCGATCGA

Reverse complement sequence

TCGATCGCTAATCACTGCGTCACGCCGTTACAACCTGACAAAGCGACACTAAATCCATTTCACAAAAGCCCAACCCCGTAACTCATTTCTGAGGATCTTC[C/T]
TTTAGGCCTTGTTTAGTTATCAAAACAGAAACTTTTCACCCATCACATCGAATGTTTAGACACATGTATGGAGTATTAAATGTGAAAAAAAAAACAATTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.90%	13.40%	3.87%	29.77%	NA
All Indica	2759	36.50%	22.60%	6.27%	34.61%	NA
All Japonica	1512	93.20%	0.20%	0.33%	6.28%	NA
Aus	269	5.60%	0.00%	0.37%	94.05%	NA
Indica I	595	9.20%	25.70%	9.75%	55.29%	NA
Indica II	465	39.60%	31.40%	8.39%	20.65%	NA
Indica III	913	58.50%	14.00%	2.19%	25.30%	NA
Indica Intermediate	786	29.80%	25.10%	7.12%	38.04%	NA
Temperate Japonica	767	99.60%	0.10%	0.00%	0.26%	NA
Tropical Japonica	504	82.10%	0.40%	0.60%	16.87%	NA
Japonica Intermediate	241	95.90%	0.00%	0.83%	3.32%	NA
VI/Aromatic	96	17.70%	1.00%	1.04%	80.21%	NA
Intermediate	90	60.00%	6.70%	3.33%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128510736	G -> A	LOC_Os01g49570.1	upstream_gene_variant ; 1163.0bp to feature; MODIFIER	silent_mutation	Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N
vg0128510736	G -> A	LOC_Os01g49580.1	upstream_gene_variant ; 2361.0bp to feature; MODIFIER	silent_mutation	Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N
vg0128510736	G -> A	LOC_Os01g49570-LOC_Os01g49580	intergenic_region ; MODIFIER	silent_mutation	Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N
vg0128510736	G -> DEL	N	N	silent_mutation	Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128510736	NA	3.02E-07	mr1471	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	2.15E-08	mr1543	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	4.82E-15	mr1583	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	2.12E-06	mr1642	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	8.54E-06	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	5.19E-07	mr1742	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	2.30E-06	mr1830	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	7.79E-06	mr1871	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	1.05E-07	mr1946	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	1.18E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	2.98E-07	mr1047_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	5.68E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	4.32E-19	mr1352_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	1.59E-08	mr1376_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	3.67E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	8.68E-09	mr1431_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	3.25E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	1.47E-11	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	1.53E-07	mr1502_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	3.20E-08	mr1526_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	2.70E-06	8.37E-12	mr1543_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	6.32E-07	mr1624_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	3.41E-11	mr1642_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	8.41E-11	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	6.10E-08	mr1808_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	3.77E-07	mr1830_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	2.04E-07	1.56E-10	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736	NA	2.09E-06	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251