\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128510736:

Variant ID: vg0128510736 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28510736
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


TAATTGTTTTTTTTTTCACATTTAATACTCCATACATGTGTCTAAACATTCGATGTGATGGGTGAAAAGTTTCTGTTTTGATAACTAAACAAGGCCTAAA[G/A]
GAAGATCCTCAGAAATGAGTTACGGGGTTGGGCTTTTGTGAAATGGATTTAGTGTCGCTTTGTCAGGTTGTAACGGCGTGACGCAGTGATTAGCGATCGA

Reverse complement sequence

TCGATCGCTAATCACTGCGTCACGCCGTTACAACCTGACAAAGCGACACTAAATCCATTTCACAAAAGCCCAACCCCGTAACTCATTTCTGAGGATCTTC[C/T]
TTTAGGCCTTGTTTAGTTATCAAAACAGAAACTTTTCACCCATCACATCGAATGTTTAGACACATGTATGGAGTATTAAATGTGAAAAAAAAAACAATTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 13.40% 3.87% 29.77% NA
All Indica  2759 36.50% 22.60% 6.27% 34.61% NA
All Japonica  1512 93.20% 0.20% 0.33% 6.28% NA
Aus  269 5.60% 0.00% 0.37% 94.05% NA
Indica I  595 9.20% 25.70% 9.75% 55.29% NA
Indica II  465 39.60% 31.40% 8.39% 20.65% NA
Indica III  913 58.50% 14.00% 2.19% 25.30% NA
Indica Intermediate  786 29.80% 25.10% 7.12% 38.04% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 82.10% 0.40% 0.60% 16.87% NA
Japonica Intermediate  241 95.90% 0.00% 0.83% 3.32% NA
VI/Aromatic  96 17.70% 1.00% 1.04% 80.21% NA
Intermediate  90 60.00% 6.70% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128510736 G -> A LOC_Os01g49570.1 upstream_gene_variant ; 1163.0bp to feature; MODIFIER silent_mutation Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0128510736 G -> A LOC_Os01g49580.1 upstream_gene_variant ; 2361.0bp to feature; MODIFIER silent_mutation Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0128510736 G -> A LOC_Os01g49570-LOC_Os01g49580 intergenic_region ; MODIFIER silent_mutation Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N
vg0128510736 G -> DEL N N silent_mutation Average:35.507; most accessible tissue: Zhenshan97 root, score: 58.674 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128510736 NA 3.02E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 2.15E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 4.82E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 2.12E-06 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 8.54E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 5.19E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 2.30E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 7.79E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 1.05E-07 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 1.18E-07 mr1042_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 2.98E-07 mr1047_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 5.68E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 4.32E-19 mr1352_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 1.59E-08 mr1376_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 3.67E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 8.68E-09 mr1431_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 3.25E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 1.47E-11 mr1471_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 1.53E-07 mr1502_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 3.20E-08 mr1526_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 2.70E-06 8.37E-12 mr1543_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 6.32E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 3.41E-11 mr1642_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 8.41E-11 mr1742_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 6.10E-08 mr1808_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 3.77E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 2.04E-07 1.56E-10 mr1871_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128510736 NA 2.09E-06 mr1970_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251