\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128501511:

Variant ID: vg0128501511 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28501511
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATAGTAACTTTGATATGCACAGTGCTGACATCCTCTGCATTAATGAAACCTTCGATGCAGAGTATCCATCCTGAATACTTTGTCTGTCCAAAGAAATT[A/C]
ATTTTCTACCTACATGTCTTACCAGCGGCTACTTTAATCTGCGGATAGTTGGAGGAACAAATAAAAAGGAGCTTATCCTGAGTTGTGTTGCGTCATGCGT

Reverse complement sequence

ACGCATGACGCAACACAACTCAGGATAAGCTCCTTTTTATTTGTTCCTCCAACTATCCGCAGATTAAAGTAGCCGCTGGTAAGACATGTAGGTAGAAAAT[T/G]
AATTTCTTTGGACAGACAAAGTATTCAGGATGGATACTCTGCATCGAAGGTTTCATTAATGCAGAGGATGTCAGCACTGTGCATATCAAAGTTACTATCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 65.40% 34.50% 0.13% 0.00% NA
All Indica  2759 90.50% 9.40% 0.11% 0.00% NA
All Japonica  1512 27.60% 72.20% 0.13% 0.00% NA
Aus  269 17.50% 82.50% 0.00% 0.00% NA
Indica I  595 80.20% 19.70% 0.17% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 97.70% 2.30% 0.00% 0.00% NA
Indica Intermediate  786 85.60% 14.20% 0.13% 0.00% NA
Temperate Japonica  767 7.40% 92.60% 0.00% 0.00% NA
Tropical Japonica  504 66.50% 33.10% 0.40% 0.00% NA
Japonica Intermediate  241 10.80% 89.20% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 61.10% 37.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128501511 A -> C LOC_Os01g49550.1 downstream_gene_variant ; 424.0bp to feature; MODIFIER silent_mutation Average:87.062; most accessible tissue: Callus, score: 99.823 N N N N
vg0128501511 A -> C LOC_Os01g49560.1 downstream_gene_variant ; 853.0bp to feature; MODIFIER silent_mutation Average:87.062; most accessible tissue: Callus, score: 99.823 N N N N
vg0128501511 A -> C LOC_Os01g49550-LOC_Os01g49560 intergenic_region ; MODIFIER silent_mutation Average:87.062; most accessible tissue: Callus, score: 99.823 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128501511 A C -0.13 -0.05 -0.04 -0.03 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128501511 NA 7.00E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 3.60E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 3.57E-08 mr1596 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 8.43E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 8.90E-06 mr1706 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 4.37E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 7.53E-08 mr1896 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 2.25E-09 mr1089_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 3.93E-07 mr1097_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 2.06E-06 mr1129_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 7.74E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 4.27E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 7.27E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 1.23E-13 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128501511 NA 1.19E-08 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251