\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128444492:

Variant ID: vg0128444492 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28444492
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCTCTTTAAAGCGCGCACACACACATATGGATGGATCAGCAGCTAGCTGCACAAGCAATAGCAATACATCGCCAGCGAGAACACGAGCTATCTGCATC[G/A]
ATGGCGGCGGCGCACTTTGTGTTCGTCCCGCTCATGGCGCAGGGCCACCTCATACCGGCGGTCGACACCGCACTGCTGCTGGCCACCCATGGCGTGCTCT

Reverse complement sequence

AGAGCACGCCATGGGTGGCCAGCAGCAGTGCGGTGTCGACCGCCGGTATGAGGTGGCCCTGCGCCATGAGCGGGACGAACACAAAGTGCGCCGCCGCCAT[C/T]
GATGCAGATAGCTCGTGTTCTCGCTGGCGATGTATTGCTATTGCTTGTGCAGCTAGCTGCTGATCCATCCATATGTGTGTGTGCGCGCTTTAAAGAGAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 16.10% 0.08% 0.00% NA
All Indica  2759 76.60% 23.30% 0.11% 0.00% NA
All Japonica  1512 95.20% 4.80% 0.00% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 76.30% 23.50% 0.17% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 58.30% 41.70% 0.00% 0.00% NA
Indica Intermediate  786 85.10% 14.60% 0.25% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 8.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128444492 G -> A LOC_Os01g49450.1 upstream_gene_variant ; 2288.0bp to feature; MODIFIER silent_mutation Average:72.935; most accessible tissue: Zhenshan97 flag leaf, score: 93.147 N N N N
vg0128444492 G -> A LOC_Os01g49460.1 upstream_gene_variant ; 1.0bp to feature; MODIFIER silent_mutation Average:72.935; most accessible tissue: Zhenshan97 flag leaf, score: 93.147 N N N N
vg0128444492 G -> A LOC_Os01g49470.1 downstream_gene_variant ; 3395.0bp to feature; MODIFIER silent_mutation Average:72.935; most accessible tissue: Zhenshan97 flag leaf, score: 93.147 N N N N
vg0128444492 G -> A LOC_Os01g49470.2 downstream_gene_variant ; 3415.0bp to feature; MODIFIER silent_mutation Average:72.935; most accessible tissue: Zhenshan97 flag leaf, score: 93.147 N N N N
vg0128444492 G -> A LOC_Os01g49450-LOC_Os01g49460 intergenic_region ; MODIFIER silent_mutation Average:72.935; most accessible tissue: Zhenshan97 flag leaf, score: 93.147 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128444492 G A -0.05 -0.04 -0.05 -0.03 -0.04 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128444492 NA 4.44E-06 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 3.07E-06 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 8.25E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 2.79E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 9.54E-07 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 1.01E-06 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 4.23E-06 4.23E-06 mr1615_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 4.00E-07 mr1624_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 7.09E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 3.81E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 1.64E-14 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128444492 NA 2.31E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251