Variant ID: vg0128438602 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 28438602 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAATCAAATGAATGGATCCTATGAAATCCTATAAAATTCCTATGGAATGCCTCTTCCCATGCAAGTTTTGGAGAAAATTTAACATGAGGTAGAACCTCTT[G/A]
GTAATTTTCCTTTGAGTCTATCTCTCTCATCCAATTCCTGTGTTTTTCCAGCGGTTCAATCAAACGGTCATTCCTGTGTTTTTCCTGCGTTTTGCAATCC
GGATTGCAAAACGCAGGAAAAACACAGGAATGACCGTTTGATTGAACCGCTGGAAAAACACAGGAATTGGATGAGAGAGATAGACTCAAAGGAAAATTAC[C/T]
AAGAGGTTCTACCTCATGTTAAATTTTCTCCAAAACTTGCATGGGAAGAGGCATTCCATAGGAATTTTATAGGATTTCATAGGATCCATTCATTTGATTC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 83.70% | 16.20% | 0.11% | 0.00% | NA |
All Indica | 2759 | 76.30% | 23.50% | 0.18% | 0.00% | NA |
All Japonica | 1512 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
Aus | 269 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
Indica I | 595 | 75.30% | 24.50% | 0.17% | 0.00% | NA |
Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica III | 913 | 58.10% | 41.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 85.10% | 14.40% | 0.51% | 0.00% | NA |
Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0128438602 | G -> A | LOC_Os01g49450.1 | downstream_gene_variant ; 2958.0bp to feature; MODIFIER | silent_mutation | Average:48.609; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
vg0128438602 | G -> A | LOC_Os01g49440-LOC_Os01g49450 | intergenic_region ; MODIFIER | silent_mutation | Average:48.609; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0128438602 | NA | 5.17E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0128438602 | NA | 3.12E-06 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0128438602 | NA | 9.70E-07 | mr1571_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0128438602 | NA | 3.18E-06 | mr1735_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0128438602 | NA | 1.23E-06 | mr1735_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0128438602 | NA | 3.14E-14 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0128438602 | NA | 4.33E-09 | mr1739_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |