\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128438602:

Variant ID: vg0128438602 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28438602
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAATCAAATGAATGGATCCTATGAAATCCTATAAAATTCCTATGGAATGCCTCTTCCCATGCAAGTTTTGGAGAAAATTTAACATGAGGTAGAACCTCTT[G/A]
GTAATTTTCCTTTGAGTCTATCTCTCTCATCCAATTCCTGTGTTTTTCCAGCGGTTCAATCAAACGGTCATTCCTGTGTTTTTCCTGCGTTTTGCAATCC

Reverse complement sequence

GGATTGCAAAACGCAGGAAAAACACAGGAATGACCGTTTGATTGAACCGCTGGAAAAACACAGGAATTGGATGAGAGAGATAGACTCAAAGGAAAATTAC[C/T]
AAGAGGTTCTACCTCATGTTAAATTTTCTCCAAAACTTGCATGGGAAGAGGCATTCCATAGGAATTTTATAGGATTTCATAGGATCCATTCATTTGATTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 16.20% 0.11% 0.00% NA
All Indica  2759 76.30% 23.50% 0.18% 0.00% NA
All Japonica  1512 95.20% 4.80% 0.00% 0.00% NA
Aus  269 85.90% 14.10% 0.00% 0.00% NA
Indica I  595 75.30% 24.50% 0.17% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 58.10% 41.90% 0.00% 0.00% NA
Indica Intermediate  786 85.10% 14.40% 0.51% 0.00% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 86.30% 13.70% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128438602 G -> A LOC_Os01g49450.1 downstream_gene_variant ; 2958.0bp to feature; MODIFIER silent_mutation Average:48.609; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N
vg0128438602 G -> A LOC_Os01g49440-LOC_Os01g49450 intergenic_region ; MODIFIER silent_mutation Average:48.609; most accessible tissue: Minghui63 panicle, score: 75.788 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128438602 NA 5.17E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128438602 NA 3.12E-06 mr1550_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128438602 NA 9.70E-07 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128438602 NA 3.18E-06 mr1735_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128438602 NA 1.23E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128438602 NA 3.14E-14 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128438602 NA 4.33E-09 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251