\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128428246:

Variant ID: vg0128428246 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28428246
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTACTTTACCATTGCGGGTGCTCTAAGACTTTCTAGCATTGTCCATATTCCTATGTATGTTAATGAATCTAGACACATTCATTAATATCTATATAAAT[G/A]
TGGATAATGCTAGATAACCTGAAATGGAGATAGTAGTCAAGTCTGTCGCCCTAAACAGCAAGGAGGTTTGGGAATAAGAAGCATTCAGGCTCAAAATGAT

Reverse complement sequence

ATCATTTTGAGCCTGAATGCTTCTTATTCCCAAACCTCCTTGCTGTTTAGGGCGACAGACTTGACTACTATCTCCATTTCAGGTTATCTAGCATTATCCA[C/T]
ATTTATATAGATATTAATGAATGTGTCTAGATTCATTAACATACATAGGAATATGGACAATGCTAGAAAGTCTTAGAGCACCCGCAATGGTAAAGTAAGG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 15.40% 0.23% 0.00% NA
All Indica  2759 82.70% 17.10% 0.14% 0.00% NA
All Japonica  1512 86.40% 13.20% 0.40% 0.00% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 73.80% 26.10% 0.17% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 77.00% 22.90% 0.11% 0.00% NA
Indica Intermediate  786 86.30% 13.50% 0.25% 0.00% NA
Temperate Japonica  767 93.70% 5.90% 0.39% 0.00% NA
Tropical Japonica  504 71.20% 28.80% 0.00% 0.00% NA
Japonica Intermediate  241 95.00% 3.70% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 82.20% 16.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128428246 G -> A LOC_Os01g49430.1 upstream_gene_variant ; 684.0bp to feature; MODIFIER silent_mutation Average:56.144; most accessible tissue: Zhenshan97 flower, score: 81.46 N N N N
vg0128428246 G -> A LOC_Os01g49440.1 upstream_gene_variant ; 3667.0bp to feature; MODIFIER silent_mutation Average:56.144; most accessible tissue: Zhenshan97 flower, score: 81.46 N N N N
vg0128428246 G -> A LOC_Os01g49420.1 downstream_gene_variant ; 3080.0bp to feature; MODIFIER silent_mutation Average:56.144; most accessible tissue: Zhenshan97 flower, score: 81.46 N N N N
vg0128428246 G -> A LOC_Os01g49430-LOC_Os01g49440 intergenic_region ; MODIFIER silent_mutation Average:56.144; most accessible tissue: Zhenshan97 flower, score: 81.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128428246 NA 2.21E-07 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 9.80E-07 mr1024_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 5.96E-07 mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 9.85E-06 mr1204_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 9.25E-06 mr1295_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 2.14E-06 mr1405_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 8.74E-07 mr1571_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 1.62E-06 1.23E-06 mr1574_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 1.37E-08 1.37E-08 mr1574_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 6.89E-06 mr1661_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 6.16E-06 mr1696_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 3.21E-13 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 5.17E-10 mr1739_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128428246 NA 3.10E-08 mr1758_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251