\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128395452:

Variant ID: vg0128395452 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28395452
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGTTTACTGTAGCACAACATTATCAAATCATGCCACAATTAGGCTTAAAAAATTCGTCTCACAATTTACACACAATCTATGTAATTAGTTATTTTTTT[C/T]
ATCTATATTTAATACTCCATGCATATGTCCCAACATTCCATATGACAGTGTGTAAAATTTTACCAGGTGATCTAAACAGGGCCTTAGTGTAAACTTCTTC

Reverse complement sequence

GAAGAAGTTTACACTAAGGCCCTGTTTAGATCACCTGGTAAAATTTTACACACTGTCATATGGAATGTTGGGACATATGCATGGAGTATTAAATATAGAT[G/A]
AAAAAAATAACTAATTACATAGATTGTGTGTAAATTGTGAGACGAATTTTTTAAGCCTAATTGTGGCATGATTTGATAATGTTGTGCTACAGTAAACATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.20% 22.60% 0.08% 0.11% NA
All Indica  2759 77.30% 22.50% 0.11% 0.14% NA
All Japonica  1512 84.90% 15.10% 0.00% 0.00% NA
Aus  269 52.40% 47.60% 0.00% 0.00% NA
Indica I  595 77.60% 21.80% 0.17% 0.34% NA
Indica II  465 67.50% 32.50% 0.00% 0.00% NA
Indica III  913 85.00% 14.80% 0.11% 0.11% NA
Indica Intermediate  786 73.80% 26.00% 0.13% 0.13% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 59.70% 40.30% 0.00% 0.00% NA
Japonica Intermediate  241 91.30% 8.70% 0.00% 0.00% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 67.80% 30.00% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128395452 C -> T LOC_Os01g49380-LOC_Os01g49390 intergenic_region ; MODIFIER silent_mutation Average:35.135; most accessible tissue: Minghui63 root, score: 63.915 N N N N
vg0128395452 C -> DEL N N silent_mutation Average:35.135; most accessible tissue: Minghui63 root, score: 63.915 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128395452 NA 5.27E-06 mr1029 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 9.43E-07 mr1047 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 4.50E-06 7.28E-06 mr1167 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 1.67E-07 mr1471 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 3.14E-06 3.14E-06 mr1479 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 1.99E-07 mr1502 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 1.97E-08 mr1543 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 4.35E-08 mr1642 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 3.28E-07 mr1742 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 9.49E-06 9.49E-06 mr1796 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 1.31E-06 1.31E-06 mr1815 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 3.58E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 7.29E-08 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 8.65E-06 NA mr1969 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128395452 NA 3.74E-06 mr1990 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251