| Variant ID: vg0128388692 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr01 | Position: 28388692 |
| Reference Allele: T | Alternative Allele: A,TA |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, A: 0.07, others allele: 0.00, population size: 100. )
AAGGAGAGCTCAAGTAGGAATACAATTTTGAAACAACTGAAATTGAAAATAAAAAATTAAAACATTAAAAGAACATAATACGGTAGTAACTAATTTTTTT[T/A,TA]
AAAAAAATTATGAAATTAGAAAAAGAAAAATAAGATTTCAATTAGGAATACAATTTATAAATAACTAAAATTTGTGATAAAAATAAAGACTATTGAAAAA
TTTTTCAATAGTCTTTATTTTTATCACAAATTTTAGTTATTTATAAATTGTATTCCTAATTGAAATCTTATTTTTCTTTTTCTAATTTCATAATTTTTTT[A/T,TA]
AAAAAAATTAGTTACTACCGTATTATGTTCTTTTAATGTTTTAATTTTTTATTTTCAATTTCAGTTGTTTCAAAATTGTATTCCTACTTGAGCTCTCCTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.50% | 36.30% | 5.54% | 0.13% | TA: 4.49% |
| All Indica | 2759 | 79.40% | 9.70% | 3.59% | 0.00% | TA: 7.32% |
| All Japonica | 1512 | 17.20% | 78.40% | 4.37% | 0.00% | TA: 0.07% |
| Aus | 269 | 14.50% | 49.10% | 32.71% | 2.23% | TA: 1.49% |
| Indica I | 595 | 79.50% | 15.50% | 5.04% | 0.00% | NA |
| Indica II | 465 | 94.60% | 4.10% | 0.43% | 0.00% | TA: 0.86% |
| Indica III | 913 | 69.40% | 7.30% | 3.18% | 0.00% | TA: 20.04% |
| Indica Intermediate | 786 | 81.90% | 11.30% | 4.83% | 0.00% | TA: 1.91% |
| Temperate Japonica | 767 | 7.20% | 86.20% | 6.65% | 0.00% | NA |
| Tropical Japonica | 504 | 26.20% | 71.60% | 2.18% | 0.00% | NA |
| Japonica Intermediate | 241 | 30.30% | 67.60% | 1.66% | 0.00% | TA: 0.41% |
| VI/Aromatic | 96 | 5.20% | 90.60% | 0.00% | 0.00% | TA: 4.17% |
| Intermediate | 90 | 37.80% | 51.10% | 10.00% | 0.00% | TA: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128388692 | T -> TA | LOC_Os01g49380.1 | upstream_gene_variant ; 1535.0bp to feature; MODIFIER | silent_mutation | Average:18.787; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0128388692 | T -> TA | LOC_Os01g49380.2 | upstream_gene_variant ; 1535.0bp to feature; MODIFIER | silent_mutation | Average:18.787; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0128388692 | T -> TA | LOC_Os01g49380-LOC_Os01g49390 | intergenic_region ; MODIFIER | silent_mutation | Average:18.787; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0128388692 | T -> A | LOC_Os01g49380.1 | upstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:18.787; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0128388692 | T -> A | LOC_Os01g49380.2 | upstream_gene_variant ; 1534.0bp to feature; MODIFIER | silent_mutation | Average:18.787; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0128388692 | T -> A | LOC_Os01g49380-LOC_Os01g49390 | intergenic_region ; MODIFIER | silent_mutation | Average:18.787; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| vg0128388692 | T -> DEL | N | N | silent_mutation | Average:18.787; most accessible tissue: Zhenshan97 panicle, score: 28.447 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128388692 | 3.68E-06 | 6.13E-06 | mr1071_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128388692 | NA | 3.44E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128388692 | NA | 8.30E-06 | mr1619_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128388692 | NA | 2.23E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128388692 | 5.35E-06 | 7.10E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |