Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128383640:

Variant ID: vg0128383640 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28383640
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, T: 0.20, others allele: 0.00, population size: 232. )

Flanking Sequence (100 bp) in Reference Genome:

GCCATGCCTTGTGATCATCATCACGGCGAGGTCCAGCAGCCTGGGCGTGTCTGGCATCGTCCGCAGCAGCAGCGGCAAGCAGGGACTCCTCCGGCGCCAT[G/T]
GGCGGATATGCTACGACCTACTGTGCTCCGCTCCAGCCAAAACGCTGCTCTTCACATGGATTAGGCCAAATCTTAGCTTGGTGACCCAATTAAACGGTAA

Reverse complement sequence

TTACCGTTTAATTGGGTCACCAAGCTAAGATTTGGCCTAATCCATGTGAAGAGCAGCGTTTTGGCTGGAGCGGAGCACAGTAGGTCGTAGCATATCCGCC[C/A]
ATGGCGCCGGAGGAGTCCCTGCTTGCCGCTGCTGCTGCGGACGATGCCAGACACGCCCAGGCTGCTGGACCTCGCCGTGATGATGATCACAAGGCATGGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.10%	43.60%	0.17%	0.06%	NA
All Indica	2759	40.70%	58.90%	0.29%	0.11%	NA
All Japonica	1512	94.80%	5.20%	0.00%	0.00%	NA
Aus	269	3.70%	96.30%	0.00%	0.00%	NA
Indica I	595	51.40%	48.20%	0.34%	0.00%	NA
Indica II	465	62.80%	36.10%	0.65%	0.43%	NA
Indica III	913	16.80%	83.00%	0.11%	0.11%	NA
Indica Intermediate	786	47.50%	52.30%	0.25%	0.00%	NA
Temperate Japonica	767	99.60%	0.40%	0.00%	0.00%	NA
Tropical Japonica	504	86.10%	13.90%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	30.20%	69.80%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128383640	G -> T	LOC_Os01g49360.1	upstream_gene_variant ; 3954.0bp to feature; MODIFIER	silent_mutation	Average:77.111; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg0128383640	G -> T	LOC_Os01g49370.1	upstream_gene_variant ; 1758.0bp to feature; MODIFIER	silent_mutation	Average:77.111; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg0128383640	G -> T	LOC_Os01g49380.1	downstream_gene_variant ; 380.0bp to feature; MODIFIER	silent_mutation	Average:77.111; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg0128383640	G -> T	LOC_Os01g49380.2	downstream_gene_variant ; 380.0bp to feature; MODIFIER	silent_mutation	Average:77.111; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg0128383640	G -> T	LOC_Os01g49370-LOC_Os01g49380	intergenic_region ; MODIFIER	silent_mutation	Average:77.111; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg0128383640	G -> DEL	N	N	silent_mutation	Average:77.111; most accessible tissue: Callus, score: 84.26	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128383640	NA	2.84E-23	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128383640	NA	7.00E-18	Plant_height	Ind_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0128383640	NA	1.40E-07	mr1186	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.24E-06	mr1616	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.87E-06	mr1639	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.53E-06	mr1648	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.53E-07	mr1662	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	4.37E-07	mr1706	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	1.12E-06	mr1960	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.04E-06	mr1060_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	1.19E-06	mr1115_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	4.59E-06	mr1220_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	7.28E-06	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.87E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	1.35E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.08E-08	mr1327_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	1.56E-06	mr1358_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.94E-08	mr1359_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	3.49E-08	mr1359_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	5.00E-06	mr1376_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	3.26E-14	mr1378_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	9.00E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.14E-07	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	3.38E-06	mr1431_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	4.85E-06	mr1442_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	4.71E-07	mr1478_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	4.07E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.19E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	5.69E-06	mr1545_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.50E-07	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	1.44E-06	mr1555_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	3.78E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	5.84E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.86E-08	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.69E-06	mr1654_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.03E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.07E-08	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	1.76E-14	mr1800_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	8.49E-06	mr1882_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	6.54E-06	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	8.79E-07	mr1968_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128383640	NA	2.99E-07	mr1971_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251