\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128247754:

Variant ID: vg0128247754 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28247754
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


CGGGCGGCGGGGCAAGGGCGCGGAGGCAGCGGCGAGGCAGCGGTACGAAAGAAGAGTGAGAGAGAGGGGAGGGGAAGAGAGAGGGTGCTGACATGGCATC[C/T]
TATACGTGGGTCGCACGCTAAATCAGCTGTCACGTTGGATAAAACTGGTGTTAAAACCACCGAATAACCTAGAGTAAACGGTTTTTTTTAAAGTTGGGGA

Reverse complement sequence

TCCCCAACTTTAAAAAAAACCGTTTACTCTAGGTTATTCGGTGGTTTTAACACCAGTTTTATCCAACGTGACAGCTGATTTAGCGTGCGACCCACGTATA[G/A]
GATGCCATGTCAGCACCCTCTCTCTTCCCCTCCCCTCTCTCTCACTCTTCTTTCGTACCGCTGCCTCGCCGCTGCCTCCGCGCCCTTGCCCCGCCGCCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.00% 45.40% 4.57% 0.95% NA
All Indica  2759 18.10% 75.50% 5.22% 1.16% NA
All Japonica  1512 94.40% 0.30% 4.50% 0.79% NA
Aus  269 87.70% 12.30% 0.00% 0.00% NA
Indica I  595 6.10% 90.80% 2.69% 0.50% NA
Indica II  465 4.50% 95.10% 0.43% 0.00% NA
Indica III  913 33.20% 54.10% 10.30% 2.41% NA
Indica Intermediate  786 17.80% 77.20% 4.07% 0.89% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 84.10% 0.40% 13.10% 2.38% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 68.90% 26.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128247754 C -> T LOC_Os01g49154.1 3_prime_UTR_variant ; 157.0bp to feature; MODIFIER silent_mutation Average:89.061; most accessible tissue: Zhenshan97 panicle, score: 95.654 N N N N
vg0128247754 C -> T LOC_Os01g49150.1 upstream_gene_variant ; 1495.0bp to feature; MODIFIER silent_mutation Average:89.061; most accessible tissue: Zhenshan97 panicle, score: 95.654 N N N N
vg0128247754 C -> T LOC_Os01g49160.1 upstream_gene_variant ; 2166.0bp to feature; MODIFIER silent_mutation Average:89.061; most accessible tissue: Zhenshan97 panicle, score: 95.654 N N N N
vg0128247754 C -> DEL N N silent_mutation Average:89.061; most accessible tissue: Zhenshan97 panicle, score: 95.654 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0128247754 C T -0.05 -0.03 -0.04 -0.03 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128247754 NA 8.83E-11 mr1151 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 2.42E-08 mr1249 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 2.24E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 4.07E-44 mr1094_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 2.36E-38 mr1110_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 4.65E-13 mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 7.69E-21 mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 1.06E-20 mr1183_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 2.98E-08 mr1215_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 1.87E-21 mr1218_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 2.85E-35 mr1221_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 7.86E-18 mr1260_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 4.32E-25 mr1422_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 2.44E-14 mr1454_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 2.32E-06 2.32E-06 mr1703_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 5.67E-12 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 7.36E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128247754 NA 1.86E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251