\
| Variant ID: vg0128147365 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28147365 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 96. )
GCCAACAACGGAAATAATCAGGTGAGATGCCCGGAGCAGATTTAGAGTGGGATTGTAGATAAGAGCAAGGATAATAATATAGCTCACTTTCTACTATTAG[T/C]
CCATCTTAAAATCAACACATATAATAGATTAGCTATAAGGTTGGCTATAATTTTTTTCTCCTCTCTCTATCTCTCACCTATATATTCAATGTATTTGTCT
AGACAAATACATTGAATATATAGGTGAGAGATAGAGAGAGGAGAAAAAAATTATAGCCAACCTTATAGCTAATCTATTATATGTGTTGATTTTAAGATGG[A/G]
CTAATAGTAGAAAGTGAGCTATATTATTATCCTTGCTCTTATCTACAATCCCACTCTAAATCTGCTCCGGGCATCTCACCTGATTATTTCCGTTGTTGGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.70% | 29.30% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 13.60% | 86.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.30% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 36.50% | 63.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 62.20% | 37.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128147365 | T -> C | LOC_Os01g49000.1 | downstream_gene_variant ; 4005.0bp to feature; MODIFIER | silent_mutation | Average:56.935; most accessible tissue: Zhenshan97 flower, score: 79.85 | N | N | N | N |
| vg0128147365 | T -> C | LOC_Os01g49000-LOC_Os01g49010 | intergenic_region ; MODIFIER | silent_mutation | Average:56.935; most accessible tissue: Zhenshan97 flower, score: 79.85 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128147365 | NA | 9.63E-12 | mr1277 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 3.96E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 6.34E-06 | mr1532 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 3.27E-06 | mr1596 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 4.60E-08 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 2.51E-21 | mr1277_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 6.35E-07 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 2.09E-06 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 9.45E-06 | mr1668_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128147365 | NA | 3.22E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |