Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0128147365:

Variant ID: vg0128147365 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28147365
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:

GCCAACAACGGAAATAATCAGGTGAGATGCCCGGAGCAGATTTAGAGTGGGATTGTAGATAAGAGCAAGGATAATAATATAGCTCACTTTCTACTATTAG[T/C]
CCATCTTAAAATCAACACATATAATAGATTAGCTATAAGGTTGGCTATAATTTTTTTCTCCTCTCTCTATCTCTCACCTATATATTCAATGTATTTGTCT

Reverse complement sequence

AGACAAATACATTGAATATATAGGTGAGAGATAGAGAGAGGAGAAAAAAATTATAGCCAACCTTATAGCTAATCTATTATATGTGTTGATTTTAAGATGG[A/G]
CTAATAGTAGAAAGTGAGCTATATTATTATCCTTGCTCTTATCTACAATCCCACTCTAAATCTGCTCCGGGCATCTCACCTGATTATTTCCGTTGTTGGC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.70%	29.30%	0.02%	0.00%	NA
All Indica	2759	98.90%	1.10%	0.00%	0.00%	NA
All Japonica	1512	13.60%	86.40%	0.00%	0.00%	NA
Aus	269	96.30%	3.30%	0.37%	0.00%	NA
Indica I	595	99.20%	0.80%	0.00%	0.00%	NA
Indica II	465	97.00%	3.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	36.50%	63.50%	0.00%	0.00%	NA
Japonica Intermediate	241	7.10%	92.90%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	62.20%	37.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128147365	T -> C	LOC_Os01g49000.1	downstream_gene_variant ; 4005.0bp to feature; MODIFIER	silent_mutation	Average:56.935; most accessible tissue: Zhenshan97 flower, score: 79.85	N	N	N	N
vg0128147365	T -> C	LOC_Os01g49000-LOC_Os01g49010	intergenic_region ; MODIFIER	silent_mutation	Average:56.935; most accessible tissue: Zhenshan97 flower, score: 79.85	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128147365	NA	9.63E-12	mr1277	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	3.96E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	6.34E-06	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	3.27E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	4.60E-08	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	2.51E-21	mr1277_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	6.35E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	2.09E-06	mr1662_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	9.45E-06	mr1668_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365	NA	3.22E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251