\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128147365:

Variant ID: vg0128147365 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28147365
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 96. )

Flanking Sequence (100 bp) in Reference Genome:


GCCAACAACGGAAATAATCAGGTGAGATGCCCGGAGCAGATTTAGAGTGGGATTGTAGATAAGAGCAAGGATAATAATATAGCTCACTTTCTACTATTAG[T/C]
CCATCTTAAAATCAACACATATAATAGATTAGCTATAAGGTTGGCTATAATTTTTTTCTCCTCTCTCTATCTCTCACCTATATATTCAATGTATTTGTCT

Reverse complement sequence

AGACAAATACATTGAATATATAGGTGAGAGATAGAGAGAGGAGAAAAAAATTATAGCCAACCTTATAGCTAATCTATTATATGTGTTGATTTTAAGATGG[A/G]
CTAATAGTAGAAAGTGAGCTATATTATTATCCTTGCTCTTATCTACAATCCCACTCTAAATCTGCTCCGGGCATCTCACCTGATTATTTCCGTTGTTGGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.70% 29.30% 0.02% 0.00% NA
All Indica  2759 98.90% 1.10% 0.00% 0.00% NA
All Japonica  1512 13.60% 86.40% 0.00% 0.00% NA
Aus  269 96.30% 3.30% 0.37% 0.00% NA
Indica I  595 99.20% 0.80% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 0.50% 99.50% 0.00% 0.00% NA
Tropical Japonica  504 36.50% 63.50% 0.00% 0.00% NA
Japonica Intermediate  241 7.10% 92.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128147365 T -> C LOC_Os01g49000.1 downstream_gene_variant ; 4005.0bp to feature; MODIFIER silent_mutation Average:56.935; most accessible tissue: Zhenshan97 flower, score: 79.85 N N N N
vg0128147365 T -> C LOC_Os01g49000-LOC_Os01g49010 intergenic_region ; MODIFIER silent_mutation Average:56.935; most accessible tissue: Zhenshan97 flower, score: 79.85 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128147365 NA 9.63E-12 mr1277 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 3.96E-06 mr1277 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 6.34E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 3.27E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 4.60E-08 mr1723 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 2.51E-21 mr1277_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 6.35E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 2.09E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 9.45E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128147365 NA 3.22E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251