| Variant ID: vg0128125660 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28125660 |
| Reference Allele: C | Alternative Allele: G,A,T |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, G: 0.04, others allele: 0.00, population size: 113. )
AAACCAGAACTATGCAAAAGTTAATTCCAATTAACATTGAAGTTACTTTTTAAAATTGTTAAACTTACGTGTGTTGATCTGTGCTGATTAAATTTAATAT[C/G,A,T]
TAGATAAAGTCATATTTTTATCCCTACAACGAATCTACTTCTAATGTCGTGACAAAGTTACTTCCGTTTTGTTTTTAGATATTTTTATAATATATATGTA
TACATATATATTATAAAAATATCTAAAAACAAAACGGAAGTAACTTTGTCACGACATTAGAAGTAGATTCGTTGTAGGGATAAAAATATGACTTTATCTA[G/C,T,A]
ATATTAAATTTAATCAGCACAGATCAACACACGTAAGTTTAACAATTTTAAAAAGTAACTTCAATGTTAATTGGAATTAACTTTTGCATAGTTCTGGTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.00% | 40.20% | 0.61% | 0.15% | A: 0.04% |
| All Indica | 2759 | 94.20% | 4.60% | 0.98% | 0.25% | NA |
| All Japonica | 1512 | 8.20% | 91.70% | 0.07% | 0.00% | NA |
| Aus | 269 | 10.40% | 88.80% | 0.00% | 0.00% | A: 0.74% |
| Indica I | 595 | 99.00% | 0.20% | 0.84% | 0.00% | NA |
| Indica II | 465 | 92.50% | 5.20% | 1.51% | 0.86% | NA |
| Indica III | 913 | 94.50% | 4.80% | 0.33% | 0.33% | NA |
| Indica Intermediate | 786 | 91.10% | 7.40% | 1.53% | 0.00% | NA |
| Temperate Japonica | 767 | 0.50% | 99.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 22.60% | 77.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 7.30% | 91.70% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 36.70% | 63.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128125660 | C -> G | LOC_Os01g48980.1 | upstream_gene_variant ; 2352.0bp to feature; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> G | LOC_Os01g48990.1 | upstream_gene_variant ; 915.0bp to feature; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> G | LOC_Os01g48990.2 | upstream_gene_variant ; 1593.0bp to feature; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> G | LOC_Os01g48980-LOC_Os01g48990 | intergenic_region ; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> T | LOC_Os01g48980.1 | upstream_gene_variant ; 2352.0bp to feature; MODIFIER | N | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> T | LOC_Os01g48990.1 | upstream_gene_variant ; 915.0bp to feature; MODIFIER | N | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> T | LOC_Os01g48990.2 | upstream_gene_variant ; 1593.0bp to feature; MODIFIER | N | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> T | LOC_Os01g48980-LOC_Os01g48990 | intergenic_region ; MODIFIER | N | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> A | LOC_Os01g48980.1 | upstream_gene_variant ; 2352.0bp to feature; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> A | LOC_Os01g48990.1 | upstream_gene_variant ; 915.0bp to feature; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> A | LOC_Os01g48990.2 | upstream_gene_variant ; 1593.0bp to feature; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> A | LOC_Os01g48980-LOC_Os01g48990 | intergenic_region ; MODIFIER | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| vg0128125660 | C -> DEL | N | N | silent_mutation | Average:29.791; most accessible tissue: Zhenshan97 panicle, score: 57.341 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128125660 | NA | 2.50E-06 | mr1189 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 3.41E-29 | mr1208 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 4.13E-06 | mr1277 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 1.40E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 5.75E-10 | mr1720 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 2.31E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 9.37E-06 | mr1734 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 6.47E-07 | mr1796 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 9.21E-07 | mr1805 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 4.08E-16 | mr1807 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | 2.92E-06 | NA | mr1969 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 1.07E-24 | mr1244_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 5.92E-08 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 1.36E-22 | mr1401_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 2.12E-25 | mr1422_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 3.26E-43 | mr1509_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 2.96E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 1.14E-16 | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128125660 | NA | 3.56E-07 | mr1834_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |