\
| Variant ID: vg0128120219 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28120219 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 245. )
TGACAATCAAACACTTTTGAATAGGTAAACATGCACTCTAATTAAGTAATGAACTGCTTAATGCATGTCAACAATACCTACTTGGCAACATATCCTATGC[A/G]
CACAGGCCCTCACGTGTACACACGTGTATACCAACTAAAAAATGTCACCAAAAAATCTAGAAAAAATCATACCCATACTTTCAATTGTATTACACCTAGG
CCTAGGTGTAATACAATTGAAAGTATGGGTATGATTTTTTCTAGATTTTTTGGTGACATTTTTTAGTTGGTATACACGTGTGTACACGTGAGGGCCTGTG[T/C]
GCATAGGATATGTTGCCAAGTAGGTATTGTTGACATGCATTAAGCAGTTCATTACTTAATTAGAGTGCATGTTTACCTATTCAAAAGTGTTTGATTGTCA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.20% | 25.50% | 0.04% | 0.25% | NA |
| All Indica | 2759 | 71.10% | 28.40% | 0.07% | 0.40% | NA |
| All Japonica | 1512 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 65.50% | 33.60% | 0.17% | 0.67% | NA |
| Indica II | 465 | 44.10% | 55.10% | 0.00% | 0.86% | NA |
| Indica III | 913 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 64.60% | 34.90% | 0.13% | 0.38% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.50% | 12.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 11.50% | 88.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128120219 | A -> G | LOC_Os01g48980.1 | intron_variant ; MODIFIER | silent_mutation | Average:50.38; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| vg0128120219 | A -> DEL | N | N | silent_mutation | Average:50.38; most accessible tissue: Zhenshan97 flower, score: 64.273 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128120219 | NA | 3.36E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | NA | 1.52E-06 | mr1445 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | NA | 3.07E-07 | mr1453 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | NA | 4.78E-06 | mr1550 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | NA | 4.07E-07 | mr1633 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | NA | 3.31E-08 | mr1706 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | 2.10E-06 | 2.10E-06 | mr1784 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | NA | 3.25E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128120219 | NA | 2.02E-07 | mr1550_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |