Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128120219:

Variant ID: vg0128120219 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28120219
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

TGACAATCAAACACTTTTGAATAGGTAAACATGCACTCTAATTAAGTAATGAACTGCTTAATGCATGTCAACAATACCTACTTGGCAACATATCCTATGC[A/G]
CACAGGCCCTCACGTGTACACACGTGTATACCAACTAAAAAATGTCACCAAAAAATCTAGAAAAAATCATACCCATACTTTCAATTGTATTACACCTAGG

Reverse complement sequence

CCTAGGTGTAATACAATTGAAAGTATGGGTATGATTTTTTCTAGATTTTTTGGTGACATTTTTTAGTTGGTATACACGTGTGTACACGTGAGGGCCTGTG[T/C]
GCATAGGATATGTTGCCAAGTAGGTATTGTTGACATGCATTAAGCAGTTCATTACTTAATTAGAGTGCATGTTTACCTATTCAAAAGTGTTTGATTGTCA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.20%	25.50%	0.04%	0.25%	NA
All Indica	2759	71.10%	28.40%	0.07%	0.40%	NA
All Japonica	1512	95.00%	5.00%	0.00%	0.00%	NA
Aus	269	11.90%	88.10%	0.00%	0.00%	NA
Indica I	595	65.50%	33.60%	0.17%	0.67%	NA
Indica II	465	44.10%	55.10%	0.00%	0.86%	NA
Indica III	913	94.10%	5.90%	0.00%	0.00%	NA
Indica Intermediate	786	64.60%	34.90%	0.13%	0.38%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	87.50%	12.50%	0.00%	0.00%	NA
Japonica Intermediate	241	95.40%	4.60%	0.00%	0.00%	NA
VI/Aromatic	96	11.50%	88.50%	0.00%	0.00%	NA
Intermediate	90	70.00%	28.90%	0.00%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128120219	A -> G	LOC_Os01g48980.1	intron_variant ; MODIFIER	silent_mutation	Average:50.38; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N
vg0128120219	A -> DEL	N	N	silent_mutation	Average:50.38; most accessible tissue: Zhenshan97 flower, score: 64.273	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128120219	NA	3.36E-07	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	NA	1.52E-06	mr1445	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	NA	3.07E-07	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	NA	4.78E-06	mr1550	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	NA	4.07E-07	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	NA	3.31E-08	mr1706	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	2.10E-06	2.10E-06	mr1784	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	NA	3.25E-10	mr1921	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128120219	NA	2.02E-07	mr1550_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251