\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128078191:

Variant ID: vg0128078191 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 28078191
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATCTTCACACTGCAGTATATTAGATCGACAATACATGCACTTGGGTGTAAGGATTTTTTGTGGTCTCAGTTGAGTTGAGGAATTTGGTTAACTTTGACA[C/T]
CTGAAGTATATTAGGTCGATGATAAATGCGCTTGTTTGCAAGGATTCATATGGTCTCAATTGGGTTGACGATTCAACAAATGTAATTCAGATTGGTCTGG

Reverse complement sequence

CCAGACCAATCTGAATTACATTTGTTGAATCGTCAACCCAATTGAGACCATATGAATCCTTGCAAACAAGCGCATTTATCATCGACCTAATATACTTCAG[G/A]
TGTCAAAGTTAACCAAATTCCTCAACTCAACTGAGACCACAAAAAATCCTTACACCCAAGTGCATGTATTGTCGATCTAATATACTGCAGTGTGAAGATT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 8.00% 0.06% 0.00% NA
All Indica  2759 98.70% 1.20% 0.11% 0.00% NA
All Japonica  1512 99.50% 0.50% 0.00% 0.00% NA
Aus  269 10.40% 89.60% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 98.60% 1.30% 0.11% 0.00% NA
Indica Intermediate  786 97.20% 2.70% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 97.50% 2.50% 0.00% 0.00% NA
VI/Aromatic  96 13.50% 86.50% 0.00% 0.00% NA
Intermediate  90 85.60% 14.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0128078191 C -> T LOC_Os01g48920.1 upstream_gene_variant ; 1763.0bp to feature; MODIFIER silent_mutation Average:18.178; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0128078191 C -> T LOC_Os01g48930.1 upstream_gene_variant ; 2201.0bp to feature; MODIFIER silent_mutation Average:18.178; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0128078191 C -> T LOC_Os01g48930.2 upstream_gene_variant ; 2201.0bp to feature; MODIFIER silent_mutation Average:18.178; most accessible tissue: Minghui63 root, score: 41.911 N N N N
vg0128078191 C -> T LOC_Os01g48920-LOC_Os01g48930 intergenic_region ; MODIFIER silent_mutation Average:18.178; most accessible tissue: Minghui63 root, score: 41.911 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0128078191 NA 1.41E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128078191 NA 3.76E-12 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128078191 NA 1.63E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128078191 NA 3.03E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128078191 7.74E-07 NA mr1987_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251