\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127831218:

Variant ID: vg0127831218 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27831218
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


CAGTAGCTTAATTACAAAGCCAGAGGCCTCTTCTCTTACTGTTAGCTAGCTGGAAATTAATCTCATATTTAAGTCGTTCTAGCTACTTTATTCATCCCAC[A/G]
ATACTTATCTTCTACTCCTGCCGTCCTAAAATATAAGCATTTTTAGCTATAAATCTGGACAATATATCCAGATTTATAGCCAAAAGCTGTTATATTTTAA

Reverse complement sequence

TTAAAATATAACAGCTTTTGGCTATAAATCTGGATATATTGTCCAGATTTATAGCTAAAAATGCTTATATTTTAGGACGGCAGGAGTAGAAGATAAGTAT[T/C]
GTGGGATGAATAAAGTAGCTAGAACGACTTAAATATGAGATTAATTTCCAGCTAGCTAACAGTAAGAGAAGAGGCCTCTGGCTTTGTAATTAAGCTACTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 14.80% 0.83% 0.02% NA
All Indica  2759 99.00% 1.00% 0.00% 0.00% NA
All Japonica  1512 55.00% 42.50% 2.51% 0.07% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.20% 2.80% 0.00% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.40% 0.00% 0.00% NA
Temperate Japonica  767 77.60% 19.90% 2.48% 0.00% NA
Tropical Japonica  504 24.60% 73.00% 2.38% 0.00% NA
Japonica Intermediate  241 46.50% 50.20% 2.90% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 68.90% 30.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127831218 A -> G LOC_Os01g48530.1 upstream_gene_variant ; 2665.0bp to feature; MODIFIER silent_mutation Average:40.674; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0127831218 A -> G LOC_Os01g48525.1 downstream_gene_variant ; 3121.0bp to feature; MODIFIER silent_mutation Average:40.674; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0127831218 A -> G LOC_Os01g48525-LOC_Os01g48530 intergenic_region ; MODIFIER silent_mutation Average:40.674; most accessible tissue: Minghui63 root, score: 63.193 N N N N
vg0127831218 A -> DEL N N silent_mutation Average:40.674; most accessible tissue: Minghui63 root, score: 63.193 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127831218 NA 1.22E-10 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 1.19E-11 mr1871 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 3.15E-21 mr1042_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 1.52E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 5.14E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 4.55E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 3.24E-06 mr1337_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 5.17E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 5.73E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 1.60E-07 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 4.27E-06 5.82E-07 mr1444_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 3.25E-08 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 3.16E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 7.31E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 2.48E-07 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 8.61E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 2.58E-08 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 4.41E-11 mr1680_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 9.51E-09 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 3.55E-06 mr1687_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 3.71E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 3.06E-13 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 6.62E-06 mr1812_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127831218 NA 1.94E-22 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251