\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127827967:

Variant ID: vg0127827967 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27827967
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGGACCGTCCACCAGAGATGCAATCGATGATGGTGACTCGAAGAAGATGAAGAAATAGAAGATTTCAAATCTACTCACAATCATTCTGGTATATATAG[A/G]
AGTACATATGGGATAGAGACTTAGAGTACAATACAAGTAAGAGTAGATTTATCTCTAGGATTATATCTCTAGGACTCTATCTTAGGATTCTATCTCTAAA

Reverse complement sequence

TTTAGAGATAGAATCCTAAGATAGAGTCCTAGAGATATAATCCTAGAGATAAATCTACTCTTACTTGTATTGTACTCTAAGTCTCTATCCCATATGTACT[T/C]
CTATATATACCAGAATGATTGTGAGTAGATTTGAAATCTTCTATTTCTTCATCTTCTTCGAGTCACCATCATCGATTGCATCTCTGGTGGACGGTCCTCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.70% 17.20% 0.02% 0.00% NA
All Indica  2759 86.40% 13.60% 0.04% 0.00% NA
All Japonica  1512 95.30% 4.70% 0.00% 0.00% NA
Aus  269 3.70% 96.30% 0.00% 0.00% NA
Indica I  595 84.40% 15.60% 0.00% 0.00% NA
Indica II  465 98.70% 1.30% 0.00% 0.00% NA
Indica III  913 78.90% 21.10% 0.00% 0.00% NA
Indica Intermediate  786 89.40% 10.40% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 88.10% 11.90% 0.00% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 77.80% 22.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127827967 A -> G LOC_Os01g48525.1 3_prime_UTR_variant ; 423.0bp to feature; MODIFIER silent_mutation Average:61.757; most accessible tissue: Minghui63 root, score: 92.303 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127827967 NA 4.16E-24 mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 2.38E-06 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 2.71E-06 2.71E-06 mr1381 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 9.53E-09 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 1.05E-08 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 9.76E-06 mr1692 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 2.13E-21 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 4.43E-06 mr1061_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 4.41E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127827967 NA 3.66E-08 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251