| Variant ID: vg0127823831 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 27823831 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATATAATTAAGTTCAAATATAGGCTCAATATGTTCAAGGGTGGCTTGTCTTGCTCGAGATCTTGAGCTTGATCCTCGAAATCCTCGCACTGCGGGTCTTC[G/A]
GGCTCCGAAACTACACGCGAAACGGGACAACTCAACAAACGGCGAAAATAAAGCCCTATTAATGACCTCTAAGCGTGCCATTAGATAGATCTCGAAATTG
CAATTTCGAGATCTATCTAATGGCACGCTTAGAGGTCATTAATAGGGCTTTATTTTCGCCGTTTGTTGAGTTGTCCCGTTTCGCGTGTAGTTTCGGAGCC[C/T]
GAAGACCCGCAGTGCGAGGATTTCGAGGATCAAGCTCAAGATCTCGAGCAAGACAAGCCACCCTTGAACATATTGAGCCTATATTTGAACTTAATTATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.70% | 3.40% | 10.96% | 2.96% | NA |
| All Indica | 2759 | 72.00% | 5.70% | 18.19% | 4.17% | NA |
| All Japonica | 1512 | 98.90% | 0.00% | 0.33% | 0.79% | NA |
| Aus | 269 | 97.40% | 0.70% | 0.37% | 1.49% | NA |
| Indica I | 595 | 78.70% | 0.80% | 16.64% | 3.87% | NA |
| Indica II | 465 | 63.40% | 6.70% | 23.01% | 6.88% | NA |
| Indica III | 913 | 74.70% | 8.00% | 14.57% | 2.74% | NA |
| Indica Intermediate | 786 | 68.80% | 6.00% | 20.74% | 4.45% | NA |
| Temperate Japonica | 767 | 99.90% | 0.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.20% | 0.00% | 0.60% | 2.18% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 92.70% | 0.00% | 1.04% | 6.25% | NA |
| Intermediate | 90 | 85.60% | 1.10% | 10.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0127823831 | G -> A | LOC_Os01g48520.1 | upstream_gene_variant ; 1741.0bp to feature; MODIFIER | silent_mutation | Average:30.922; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg0127823831 | G -> A | LOC_Os01g48525.1 | upstream_gene_variant ; 3142.0bp to feature; MODIFIER | silent_mutation | Average:30.922; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg0127823831 | G -> A | LOC_Os01g48520-LOC_Os01g48525 | intergenic_region ; MODIFIER | silent_mutation | Average:30.922; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| vg0127823831 | G -> DEL | N | N | silent_mutation | Average:30.922; most accessible tissue: Minghui63 young leaf, score: 48.378 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0127823831 | 1.65E-06 | 2.79E-06 | mr1134 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127823831 | 1.70E-06 | NA | mr1142 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127823831 | 3.08E-07 | 3.08E-07 | mr1926 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127823831 | NA | 1.20E-07 | mr1527_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0127823831 | NA | 1.45E-06 | mr1527_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |