\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127817482:

Variant ID: vg0127817482 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27817482
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGTGTCATAATATACTAATTATGTTTAGATCATAGTGTTATAATATATATGGATAAGCAATTTAACTATAGATTTTGTCAAAAGTCATCGGTGTCACC[C/T]
GACATCGACCATTATACTATAGATCCGCTCCAGGTGCTTATGAATGTTACACACGAGTGCACTTTTAATAAGAATTTAATTGTGCTAGGGATGTATCACT

Reverse complement sequence

AGTGATACATCCCTAGCACAATTAAATTCTTATTAAAAGTGCACTCGTGTGTAACATTCATAAGCACCTGGAGCGGATCTATAGTATAATGGTCGATGTC[G/A]
GGTGACACCGATGACTTTTGACAAAATCTATAGTTAAATTGCTTATCCATATATATTATAACACTATGATCTAAACATAATTAGTATATTATGACACACC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.90% 1.50% 0.61% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 93.40% 4.70% 1.92% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 100.00% 0.00% 0.00% 0.00% NA
Temperate Japonica  767 87.20% 9.30% 3.52% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 100.00% 0.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127817482 C -> T LOC_Os01g48520.1 downstream_gene_variant ; 2336.0bp to feature; MODIFIER silent_mutation Average:51.043; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N
vg0127817482 C -> T LOC_Os01g48500-LOC_Os01g48520 intergenic_region ; MODIFIER silent_mutation Average:51.043; most accessible tissue: Zhenshan97 root, score: 81.772 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127817482 NA 2.13E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127817482 NA 9.73E-06 mr1215 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127817482 NA 4.24E-07 mr1358 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127817482 NA 4.39E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127817482 NA 3.80E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127817482 5.47E-06 5.47E-06 mr1967 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251